Incidental Mutation 'R5251:Nup205'
ID399031
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Namenucleoporin 205
Synonyms3830404O05Rik
MMRRC Submission 042822-MU
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location35177421-35247596 bp(+) (GRCm38)
Type of Mutationintron (4523 bp from exon)
DNA Base Change (assembly) A to G at 35196482 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
Predicted Effect probably benign
Transcript: ENSMUST00000043815
AA Change: M423V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: M423V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201374
AA Change: M476V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: M476V

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202898
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0543:Nup205 UTSW 6 35198969 missense probably benign
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1033:Nup205 UTSW 6 35227442 missense probably benign
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1769:Nup205 UTSW 6 35205431 missense probably damaging 1.00
R1839:Nup205 UTSW 6 35219714 missense probably benign 0.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.34
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5760:Nup205 UTSW 6 35247343 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7428:Nup205 UTSW 6 35227559 missense probably damaging 1.00
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACCTATTGAACCATCTCCCTGG -3'
(R):5'- GTTCACCAATCTGCAGAGAATAAGC -3'

Sequencing Primer
(F):5'- GGCTCTCTCTGATCCTTAAGATAC -3'
(R):5'- CAATCTGCAGAGAATAAGCAAAAAC -3'
Posted On2016-07-06