Mutagenetix > Incidental Mutation

Incidental Mutation 'R5251:Arhgef5'

399034

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

042822-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43272881 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 189 (T189A)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031750
AA Change: T189A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: T189A

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1	A	T	5: 35,950,892	E194V	probably damaging	Het
Ankrd16	T	A	2: 11,778,741	D51E	probably damaging	Het
Camk4	A	G	18: 33,184,879	D363G	probably benign	Het
Camta1	A	G	4: 151,163,884	I199T	probably damaging	Het
Ccdc141	C	T	2: 77,027,774	C1021Y	probably damaging	Het
Cdc34	C	T	10: 79,685,256	S129L	probably damaging	Het
Cenph	T	A	13: 100,761,840	N185I	possibly damaging	Het
Colq	A	G	14: 31,539,819		probably null	Het
Dph2	A	T	4: 117,890,346	D280E	probably damaging	Het
Exosc5	A	G	7: 25,667,755	Y224C	probably damaging	Het
Fgfr3	C	T	5: 33,735,556		probably benign	Het
Hs3st6	T	A	17: 24,757,985	D146E	probably benign	Het
Igkv13-84	A	T	6: 68,939,788	Q23L	probably benign	Het
Macf1	A	G	4: 123,449,967	V2154A	probably benign	Het
Man1a2	T	C	3: 100,620,099	E225G	probably damaging	Het
Mertk	T	C	2: 128,729,455	S110P	probably damaging	Het
Nav3	A	G	10: 109,853,253	F388L	probably damaging	Het
Nme8	T	C	13: 19,660,625	N98S	probably benign	Het
Nup205	A	G	6: 35,196,482		probably null	Het
Prl7d1	T	C	13: 27,709,244	N228S	probably benign	Het
Prss23	T	C	7: 89,510,322	K180E	probably damaging	Het
Psap	G	A	10: 60,301,700	D549N	probably damaging	Het
Sec16a	A	G	2: 26,439,345	V886A	probably benign	Het
Sh2d1b2	A	T	1: 170,250,073	E81D	probably benign	Het
Tbx6	A	T	7: 126,783,344	N254I	probably damaging	Het
Tchhl1	T	C	3: 93,470,553	V188A	possibly damaging	Het
Trpc3	A	T	3: 36,670,954	L291Q	probably damaging	Het
Zbtb38	G	T	9: 96,687,108	T641N	probably benign	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AAGAACAATAGCTGCCCCTG -3'
(R):5'- AATGCCTTCGTTCAGAGTTCC -3'

Sequencing Primer
(F):5'- AATAGCTGCCCCTGAGCTC -3'
(R):5'- AGAGTTCCTTCCTCCTGAATTTCTAC -3'

Posted On

2016-07-06