Incidental Mutation 'R5251:Igkv13-84'
ID399036
Institutional Source Beutler Lab
Gene Symbol Igkv13-84
Ensembl Gene ENSMUSG00000076538
Gene Nameimmunoglobulin kappa chain variable 13-84
SynonymsIgk-V33
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location68939602-68940067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68939788 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 23 (Q23L)
Ref Sequence ENSEMBL: ENSMUSP00000100140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103339]
Predicted Effect probably benign
Transcript: ENSMUST00000103339
AA Change: Q23L

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100140
Gene: ENSMUSG00000076538
AA Change: Q23L

DomainStartEndE-ValueType
low complexity region 27 34 N/A INTRINSIC
IGv 38 110 2.55e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Igkv13-84
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0699:Igkv13-84 UTSW 6 68939651 critical splice donor site probably benign
R4347:Igkv13-84 UTSW 6 68939776 missense probably benign
R4621:Igkv13-84 UTSW 6 68939799 missense possibly damaging 0.91
R4779:Igkv13-84 UTSW 6 68939910 missense probably damaging 1.00
R5110:Igkv13-84 UTSW 6 68939608 missense probably benign
R6194:Igkv13-84 UTSW 6 68939932 missense possibly damaging 0.95
R6359:Igkv13-84 UTSW 6 68939608 missense probably benign
R6574:Igkv13-84 UTSW 6 68939993 nonsense probably null
R7131:Igkv13-84 UTSW 6 68939780 nonsense probably null
R7837:Igkv13-84 UTSW 6 68939809 missense possibly damaging 0.60
R7920:Igkv13-84 UTSW 6 68939809 missense possibly damaging 0.60
Z1177:Igkv13-84 UTSW 6 68939860 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTCAGGTCACAGCAGAAAC -3'
(R):5'- AGATCCACTGCCACTGAATCTTG -3'

Sequencing Primer
(F):5'- TCAGGTCACAGCAGAAACATGAAG -3'
(R):5'- CTGAATCTTGAAGGAACCCCAGTTTC -3'
Posted On2016-07-06