Incidental Mutation 'R5251:Exosc5'
ID399038
Institutional Source Beutler Lab
Gene Symbol Exosc5
Ensembl Gene ENSMUSG00000061286
Gene Nameexosome component 5
SynonymsD7Wsu180e
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25659164-25671368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25667755 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 224 (Y224C)
Ref Sequence ENSEMBL: ENSMUSP00000145948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079439] [ENSMUST00000079634] [ENSMUST00000108404] [ENSMUST00000108405] [ENSMUST00000205743] [ENSMUST00000205966] [ENSMUST00000206561]
Predicted Effect probably benign
Transcript: ENSMUST00000079439
SMART Domains Protein: ENSMUSP00000078407
Gene: ENSMUSG00000061702

DomainStartEndE-ValueType
low complexity region 74 85 N/A INTRINSIC
Pfam:CD225 86 158 2.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079634
AA Change: Y224C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078580
Gene: ENSMUSG00000061286
AA Change: Y224C

DomainStartEndE-ValueType
Pfam:RNase_PH 27 147 1.3e-25 PFAM
Pfam:RNase_PH_C 150 216 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108404
SMART Domains Protein: ENSMUSP00000104041
Gene: ENSMUSG00000061702

DomainStartEndE-ValueType
Pfam:Dispanin 82 121 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108405
SMART Domains Protein: ENSMUSP00000104042
Gene: ENSMUSG00000061702

DomainStartEndE-ValueType
Pfam:Dispanin 82 134 6.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150306
Predicted Effect probably benign
Transcript: ENSMUST00000150883
SMART Domains Protein: ENSMUSP00000115089
Gene: ENSMUSG00000061702

DomainStartEndE-ValueType
Pfam:CD225 32 68 5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205614
Predicted Effect probably benign
Transcript: ENSMUST00000205743
Predicted Effect probably benign
Transcript: ENSMUST00000205966
Predicted Effect probably damaging
Transcript: ENSMUST00000206561
AA Change: Y224C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Exosc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Exosc5 APN 7 25665563 critical splice donor site probably null
IGL02730:Exosc5 APN 7 25663197 missense possibly damaging 0.92
R2267:Exosc5 UTSW 7 25664384 missense possibly damaging 0.89
R7175:Exosc5 UTSW 7 25664369 missense probably damaging 0.96
R7297:Exosc5 UTSW 7 25666326 missense probably benign 0.00
R7448:Exosc5 UTSW 7 25659309 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCGTGACATTGTCTCATTGTG -3'
(R):5'- CAGGCCTAGAATGTCCCTAAGC -3'

Sequencing Primer
(F):5'- ACATTGTCTCATTGTGGGGTG -3'
(R):5'- TAGAATGTCCCTAAGCCCCCAC -3'
Posted On2016-07-06