Incidental Mutation 'R5251:Prss23'
ID 399040
Institutional Source Beutler Lab
Gene Symbol Prss23
Ensembl Gene ENSMUSG00000039405
Gene Name protease, serine 23
Synonyms 2310046G15Rik
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R5251 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 89507783-89527187 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89510322 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 180 (K180E)
Ref Sequence ENSEMBL: ENSMUSP00000147183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041761] [ENSMUST00000207538] [ENSMUST00000207636] [ENSMUST00000207932] [ENSMUST00000208402] [ENSMUST00000208888] [ENSMUST00000208903]
AlphaFold Q9D6X6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032858
Predicted Effect probably damaging
Transcript: ENSMUST00000041761
AA Change: K180E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045191
Gene: ENSMUSG00000039405
AA Change: K180E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 48 57 N/A INTRINSIC
Tryp_SPc 137 372 2.87e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179361
Predicted Effect probably benign
Transcript: ENSMUST00000207538
Predicted Effect probably benign
Transcript: ENSMUST00000207636
Predicted Effect probably damaging
Transcript: ENSMUST00000207932
AA Change: K180E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208814
Predicted Effect probably benign
Transcript: ENSMUST00000208888
Predicted Effect probably benign
Transcript: ENSMUST00000208903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209118
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Prss23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Prss23 APN 7 89509887 missense possibly damaging 0.83
IGL03308:Prss23 APN 7 89509730 missense probably benign 0.09
IGL03349:Prss23 APN 7 89509857 missense probably benign 0.09
IGL03378:Prss23 APN 7 89510144 missense probably damaging 0.99
R0394:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R1026:Prss23 UTSW 7 89509958 missense probably benign 0.01
R1417:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1691:Prss23 UTSW 7 89510714 missense probably benign 0.18
R1806:Prss23 UTSW 7 89510391 missense probably damaging 1.00
R2153:Prss23 UTSW 7 89509911 missense probably damaging 1.00
R3420:Prss23 UTSW 7 89509899 missense possibly damaging 0.91
R3849:Prss23 UTSW 7 89509751 missense probably damaging 1.00
R4567:Prss23 UTSW 7 89510866 utr 5 prime probably benign
R4828:Prss23 UTSW 7 89509900 nonsense probably null
R5010:Prss23 UTSW 7 89510214 missense probably benign 0.25
R5399:Prss23 UTSW 7 89509966 missense probably benign 0.02
R5629:Prss23 UTSW 7 89510192 missense probably damaging 1.00
R5697:Prss23 UTSW 7 89509982 missense probably damaging 0.99
R6378:Prss23 UTSW 7 89510033 missense probably damaging 1.00
R6716:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R6880:Prss23 UTSW 7 89510825 missense probably benign 0.03
R7097:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R7362:Prss23 UTSW 7 89509764 missense probably damaging 1.00
R7563:Prss23 UTSW 7 89509830 missense probably damaging 1.00
R7637:Prss23 UTSW 7 89510246 missense probably benign 0.00
R7815:Prss23 UTSW 7 89510045 missense probably damaging 0.99
R8047:Prss23 UTSW 7 89509928 missense probably damaging 1.00
R8548:Prss23 UTSW 7 89510208 missense probably benign 0.21
R8869:Prss23 UTSW 7 89510679 missense probably benign 0.00
R8914:Prss23 UTSW 7 89510646 missense probably benign
R9310:Prss23 UTSW 7 89509934 missense probably damaging 1.00
R9729:Prss23 UTSW 7 89510723 missense probably benign
R9762:Prss23 UTSW 7 89510475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATGCCGATGTCATTGG -3'
(R):5'- CATCCTCAGCAATGGTGAAGGC -3'

Sequencing Primer
(F):5'- CCGATGTCATTGGCATTGC -3'
(R):5'- AGGCCACAGGGAGATCTC -3'
Posted On 2016-07-06