Incidental Mutation 'R5251:Prl7d1'
ID 399055
Institutional Source Beutler Lab
Gene Symbol Prl7d1
Ensembl Gene ENSMUSG00000021348
Gene Name prolactin family 7, subfamily d, member 1
Synonyms Plfr, PRP, PLF-RP
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5251 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 27706337-27716736 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27709244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 228 (N228S)
Ref Sequence ENSEMBL: ENSMUSP00000153033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021776] [ENSMUST00000224026]
AlphaFold P04769
Predicted Effect probably benign
Transcript: ENSMUST00000021776
AA Change: N227S

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021776
Gene: ENSMUSG00000021348
AA Change: N227S

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224026
AA Change: N228S

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Prl7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Prl7d1 APN 13 27710166 missense possibly damaging 0.91
IGL01735:Prl7d1 APN 13 27714389 missense possibly damaging 0.83
IGL02139:Prl7d1 APN 13 27712083 missense probably damaging 1.00
PIT4305001:Prl7d1 UTSW 13 27714337 missense possibly damaging 0.90
PIT4531001:Prl7d1 UTSW 13 27710178 missense probably damaging 1.00
R0555:Prl7d1 UTSW 13 27712055 missense probably benign 0.13
R0625:Prl7d1 UTSW 13 27710140 missense probably benign 0.10
R0631:Prl7d1 UTSW 13 27710182 missense probably benign 0.32
R0837:Prl7d1 UTSW 13 27714338 missense probably benign 0.06
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1459:Prl7d1 UTSW 13 27709257 missense possibly damaging 0.81
R1643:Prl7d1 UTSW 13 27712131 missense possibly damaging 0.53
R1691:Prl7d1 UTSW 13 27709382 missense probably damaging 0.97
R2016:Prl7d1 UTSW 13 27710173 missense probably damaging 1.00
R3873:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R3874:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R5275:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5295:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5398:Prl7d1 UTSW 13 27710074 missense probably damaging 1.00
R6798:Prl7d1 UTSW 13 27709397 critical splice acceptor site probably null
R6818:Prl7d1 UTSW 13 27714471 missense probably benign 0.07
R6825:Prl7d1 UTSW 13 27710142 missense probably benign 0.01
R7478:Prl7d1 UTSW 13 27710185 nonsense probably null
R7795:Prl7d1 UTSW 13 27709280 missense probably damaging 1.00
R7995:Prl7d1 UTSW 13 27710071 missense probably benign
R8193:Prl7d1 UTSW 13 27709247 missense
R9313:Prl7d1 UTSW 13 27709199 missense probably benign
R9424:Prl7d1 UTSW 13 27710202 missense probably benign 0.00
R9430:Prl7d1 UTSW 13 27714377 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GACTTAAGCCACAGAAGAATGC -3'
(R):5'- CCTTTAGAAGGCATAGGTCAAAGG -3'

Sequencing Primer
(F):5'- TCAACAGCTGAAAATGAGTTGAG -3'
(R):5'- GCATAGGTCAAAGGAATACAAACAC -3'
Posted On 2016-07-06