Mutagenetix > Incidental Mutations

Incidental Mutation 'R5174:Pdzd2'

399058

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

042754-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R5174 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12372514 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 2512 (P2512S)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317]

Predicted Effect

probably benign
Transcript: ENSMUST00000075317
AA Change: P2512S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: P2512S

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Meta Mutation Damage Score

0.1602

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	C	T	9: 103,282,556		probably null	Het
Ank3	T	C	10: 69,892,379	S632P	probably damaging	Het
Arhgef16	G	A	4: 154,282,047	R451W	probably damaging	Het
Asxl3	A	T	18: 22,523,115	D1394V	probably benign	Het
Atp2a3	T	A	11: 72,980,215	I545N	probably damaging	Het
Cadps2	T	A	6: 23,287,743	Y1181F	probably damaging	Het
Camkmt	C	A	17: 85,452,237	F268L	probably benign	Het
Casp14	C	T	10: 78,715,391	G20D	possibly damaging	Het
Celf1	T	C	2: 91,001,008	C61R	probably damaging	Het
Cenpp	CAAACCTGAAAA	CAAA	13: 49,464,782		probably null	Het
Cers3	A	T	7: 66,784,868	K203M	probably damaging	Het
Clip4	T	C	17: 71,810,962	F334S	probably damaging	Het
Cyp2b13	T	A	7: 26,088,693	D415E	possibly damaging	Het
Decr2	A	T	17: 26,087,469		probably null	Het
Dmxl2	T	C	9: 54,445,484		probably null	Het
Dnah7b	G	A	1: 46,243,349	A2881T	possibly damaging	Het
Dnaja3	A	G	16: 4,684,297	H55R	probably benign	Het
Dnajc11	T	C	4: 151,979,984	F531L	probably damaging	Het
Efcab6	A	G	15: 84,054,486	F10L	probably benign	Het
Epm2aip1	T	C	9: 111,273,387	F476S	probably damaging	Het
Fat3	T	C	9: 15,999,570	N1712S	probably damaging	Het
Flnc	T	C	6: 29,448,894	V1343A	possibly damaging	Het
Fsip2	C	T	2: 82,980,741	P2468L	probably benign	Het
Gm5798	A	G	14: 41,348,663	H10R	possibly damaging	Het
Gm7168	A	G	17: 13,948,455	Y28C	probably damaging	Het
Gm9866	A	T	12: 27,142,028		noncoding transcript	Het
Gtpbp6	G	A	5: 110,108,117	R19C	possibly damaging	Het
Gucy2e	A	G	11: 69,236,566	F27S	probably benign	Het
Krba1	A	G	6: 48,412,295	E548G	probably damaging	Het
Ltbr	A	G	6: 125,309,537	S229P	probably benign	Het
Mgat5b	A	T	11: 116,977,715	Y488F	probably benign	Het
Mia3	T	A	1: 183,331,493	K475*	probably null	Het
Mrpl53	C	T	6: 83,109,657	T114M	possibly damaging	Het
Mrps35	T	C	6: 147,060,211	Y195H	possibly damaging	Het
Muc4	A	T	16: 32,751,738	I539F	possibly damaging	Het
Nedd1	T	A	10: 92,711,212	T150S	possibly damaging	Het
Nox4	T	G	7: 87,323,766	I327S	probably benign	Het
Nrk	C	G	X: 138,986,779	A1018G	probably benign	Het
Olfr1152	T	A	2: 87,868,411	V140E	possibly damaging	Het
Olfr1189	T	A	2: 88,592,648	N281K	probably damaging	Het
Olfr608	T	A	7: 103,470,403	F121L	probably benign	Het
Olfr984	T	C	9: 40,100,747	T248A	possibly damaging	Het
Ptgis	T	A	2: 167,203,470		probably null	Het
Rnf170	T	A	8: 26,129,168	M140K	probably benign	Het
Scaf4	A	T	16: 90,247,174	I637K	unknown	Het
Sdccag8	A	T	1: 176,845,350	T270S	probably damaging	Het
Sec24d	T	C	3: 123,364,926	C1022R	probably damaging	Het
Sec63	T	C	10: 42,829,081		probably benign	Het
Serpinb3d	C	G	1: 107,078,498	E287Q	possibly damaging	Het
Smarcd2	A	G	11: 106,267,045		probably benign	Het
Sox15	A	G	11: 69,655,719	Y116C	probably damaging	Het
Spag16	T	C	1: 70,493,796	S545P	probably damaging	Het
Ssc5d	C	A	7: 4,927,971	T184N	possibly damaging	Het
St6galnac2	A	T	11: 116,681,947	F228I	probably damaging	Het
Syne1	T	C	10: 5,041,490	N8408S	probably damaging	Het
Trank1	A	C	9: 111,365,559	T884P	probably benign	Het
Ubr3	T	A	2: 70,009,162	L1540H	probably damaging	Het
Ugt2b37	C	A	5: 87,251,880	M256I	probably benign	Het
Vmn2r69	G	A	7: 85,415,531	T49I	possibly damaging	Het
Vmn2r72	T	A	7: 85,737,840	I839L	probably benign	Het
Zcrb1	A	G	15: 93,387,575		probably null	Het
Zfp319	A	T	8: 95,328,169		probably null	Het
Zfp592	T	C	7: 81,038,325	S1000P	probably damaging	Het
Zfp938	T	C	10: 82,226,004	N261D	possibly damaging	Het
Zfp957	A	G	14: 79,213,388	S324P	unknown	Het
Zswim6	G	T	13: 107,726,681		noncoding transcript	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGGCTTCCAGGACTGATACTG -3'
(R):5'- TGCTCTTTAGAACCCAACTGG -3'

Sequencing Primer
(F):5'- CATTGGTGGAATCGACTCAGC -3'
(R):5'- TGGAGATAACCCCCAGAAGGTC -3'

Posted On

2016-07-06