Incidental Mutation 'R5174:Efcab6'
ID399060
Institutional Source Beutler Lab
Gene Symbol Efcab6
Ensembl Gene ENSMUSG00000022441
Gene NameEF-hand calcium binding domain 6
Synonyms4931407K02Rik, 4932408N08Rik
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83866712-84065379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84054486 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 10 (F10L)
Ref Sequence ENSEMBL: ENSMUSP00000114909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156187]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122836
Predicted Effect probably benign
Transcript: ENSMUST00000156187
AA Change: F10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114909
Gene: ENSMUSG00000022441
AA Change: F10L

DomainStartEndE-ValueType
EFh 100 128 9.33e-2 SMART
low complexity region 162 172 N/A INTRINSIC
EFh 201 229 5e-2 SMART
EFh 325 353 1.59e1 SMART
EFh 532 560 1.17e2 SMART
low complexity region 598 607 N/A INTRINSIC
EFh 659 687 8.82e1 SMART
EFh 767 795 3.71e0 SMART
low complexity region 802 816 N/A INTRINSIC
EFh 909 937 2.46e-1 SMART
low complexity region 962 977 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
EFh 1090 1118 2.09e0 SMART
low complexity region 1131 1136 N/A INTRINSIC
EFh 1197 1225 2e1 SMART
Blast:EFh 1233 1261 1e-9 BLAST
EFh 1342 1370 3.48e-1 SMART
EFh 1453 1481 2.49e0 SMART
Blast:EFh 1489 1516 6e-9 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which directly binds the oncogene DJ-1 and androgen receptor to form a ternary complex in cells. This binding protein recruits histone-deacetylase complexes in order to repress transcription activity of androgen receptor. This protein may also play a role in spermatogenesis and fertilization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Efcab6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Efcab6 APN 15 84018642 missense probably benign 0.09
IGL00946:Efcab6 APN 15 84018696 missense probably benign 0.19
IGL01063:Efcab6 APN 15 84054512 start codon destroyed probably null 0.53
IGL01330:Efcab6 APN 15 84044300 missense probably benign 0.26
IGL01372:Efcab6 APN 15 84044304 missense possibly damaging 0.62
IGL01644:Efcab6 APN 15 84033072 missense probably damaging 0.97
IGL02175:Efcab6 APN 15 83896100 missense probably damaging 0.98
IGL02449:Efcab6 APN 15 84010033 missense probably benign 0.00
IGL02514:Efcab6 APN 15 84032942 missense possibly damaging 0.91
IGL02514:Efcab6 APN 15 83871311 splice site probably benign
IGL02538:Efcab6 APN 15 84054521 start gained probably benign
IGL02623:Efcab6 APN 15 83879448 missense probably damaging 0.99
IGL02735:Efcab6 APN 15 83899697 missense probably damaging 1.00
IGL03139:Efcab6 APN 15 83952221 missense probably benign 0.04
IGL03274:Efcab6 APN 15 83868249 missense probably damaging 1.00
IGL03400:Efcab6 APN 15 83867045 utr 3 prime probably benign
P0045:Efcab6 UTSW 15 83918199 missense probably damaging 1.00
PIT4445001:Efcab6 UTSW 15 83904267 missense probably benign 0.03
PIT4486001:Efcab6 UTSW 15 83973313 missense probably benign 0.00
PIT4618001:Efcab6 UTSW 15 83983446 missense probably benign 0.25
R0520:Efcab6 UTSW 15 83950046 missense probably benign 0.00
R0575:Efcab6 UTSW 15 83967700 missense probably benign 0.28
R0648:Efcab6 UTSW 15 83933064 splice site probably benign
R0894:Efcab6 UTSW 15 83918292 missense probably benign 0.00
R0975:Efcab6 UTSW 15 83973331 missense probably benign 0.00
R1238:Efcab6 UTSW 15 83933137 missense probably benign 0.06
R1625:Efcab6 UTSW 15 83947638 missense probably benign
R1651:Efcab6 UTSW 15 83870993 missense possibly damaging 0.50
R1691:Efcab6 UTSW 15 83933206 missense probably benign 0.01
R1844:Efcab6 UTSW 15 83967621 missense possibly damaging 0.47
R1929:Efcab6 UTSW 15 83892962 splice site probably benign
R1983:Efcab6 UTSW 15 83892962 splice site probably benign
R2100:Efcab6 UTSW 15 83892967 splice site probably null
R2271:Efcab6 UTSW 15 83946999 missense probably benign
R2329:Efcab6 UTSW 15 83950048 missense possibly damaging 0.90
R3618:Efcab6 UTSW 15 83950069 missense probably benign 0.00
R3687:Efcab6 UTSW 15 83871278 nonsense probably null
R3688:Efcab6 UTSW 15 83871278 nonsense probably null
R4212:Efcab6 UTSW 15 83892863 missense probably damaging 1.00
R4223:Efcab6 UTSW 15 83867108 missense probably damaging 1.00
R4459:Efcab6 UTSW 15 83904289 missense probably damaging 1.00
R4578:Efcab6 UTSW 15 83933168 missense probably benign 0.00
R4600:Efcab6 UTSW 15 83946925 missense probably benign
R5260:Efcab6 UTSW 15 83945123 missense probably benign 0.01
R5576:Efcab6 UTSW 15 83950000 missense probably benign 0.05
R5718:Efcab6 UTSW 15 83904238 missense probably damaging 1.00
R5797:Efcab6 UTSW 15 83924277 missense possibly damaging 0.82
R6027:Efcab6 UTSW 15 83967721 missense probably benign
R6110:Efcab6 UTSW 15 83879634 missense possibly damaging 0.69
R6132:Efcab6 UTSW 15 84032972 missense probably damaging 1.00
R6166:Efcab6 UTSW 15 83896115 missense probably benign 0.01
R6228:Efcab6 UTSW 15 83967624 missense possibly damaging 0.67
R6341:Efcab6 UTSW 15 83935938 missense possibly damaging 0.65
R6445:Efcab6 UTSW 15 83868357 missense probably damaging 1.00
R6494:Efcab6 UTSW 15 84044322 critical splice acceptor site probably null
R6611:Efcab6 UTSW 15 83892835 missense possibly damaging 0.68
R7392:Efcab6 UTSW 15 83988951 missense probably benign 0.39
R7599:Efcab6 UTSW 15 83870988 missense probably damaging 1.00
R7711:Efcab6 UTSW 15 83949924 missense probably benign 0.00
R7873:Efcab6 UTSW 15 84018625 critical splice donor site probably null
R8031:Efcab6 UTSW 15 83983498 missense possibly damaging 0.90
R8075:Efcab6 UTSW 15 83967623 missense probably damaging 0.99
R8209:Efcab6 UTSW 15 83904255 missense probably benign 0.04
R8226:Efcab6 UTSW 15 83904255 missense probably benign 0.04
R8710:Efcab6 UTSW 15 84018648 missense probably benign 0.00
R8869:Efcab6 UTSW 15 84044231 missense probably damaging 0.97
X0019:Efcab6 UTSW 15 83879483 missense possibly damaging 0.92
X0064:Efcab6 UTSW 15 83983493 missense probably benign 0.08
Z1088:Efcab6 UTSW 15 83955009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGATAATCAGCTTCAGGCC -3'
(R):5'- GAGAATGTGCCTACAGTGCTC -3'

Sequencing Primer
(F):5'- GTTGATAATCAGCTTCAGGCCACTAC -3'
(R):5'- TCACAGACTAGCTTCACGTATGG -3'
Posted On2016-07-06