Incidental Mutation 'R5174:Dnaja3'
ID399062
Institutional Source Beutler Lab
Gene Symbol Dnaja3
Ensembl Gene ENSMUSG00000004069
Gene NameDnaJ heat shock protein family (Hsp40) member A3
Synonyms1810053A11Rik, 1200003J13Rik, Tid-1
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5174 (G1)
Quality Score221
Status Validated
Chromosome16
Chromosomal Location4639989-4707695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4684297 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 55 (H55R)
Ref Sequence ENSEMBL: ENSMUSP00000155588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000060067] [ENSMUST00000090480] [ENSMUST00000115854] [ENSMUST00000135823] [ENSMUST00000229529]
Predicted Effect probably benign
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060067
AA Change: H55R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053842
Gene: ENSMUSG00000004069
AA Change: H55R

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
DnaJ 92 150 4.57e-31 SMART
Pfam:DnaJ_C 209 413 4.4e-23 PFAM
Pfam:DnaJ_CXXCXGXG 236 296 2.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090480
SMART Domains Protein: ENSMUSP00000087966
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115854
AA Change: H55R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111520
Gene: ENSMUSG00000004069
AA Change: H55R

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
DnaJ 92 150 4.57e-31 SMART
Pfam:DnaJ_CXXCXGXG 236 296 3.9e-14 PFAM
Pfam:CTDII 345 423 1.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127850
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144815
Predicted Effect probably benign
Transcript: ENSMUST00000229529
AA Change: H55R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ/Hsp40 protein family. DNAJ/Hsp40 proteins stimulate the ATPase activity of Hsp70 chaperones and play critical roles in protein folding, degradation, and multimeric complex assembly. The encoded protein is localized to mitochondria and mediates several cellular processes including proliferation, survival and apoptotic signal transduction. The encoded protein also plays a critical role in tumor suppression through interactions with oncogenic proteins including ErbB2 and the p53 tumor suppressor protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Early embryonic development of homozygous null embryos is disrupted. Blastocysts develop and implant but die afterwards. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Dnaja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Dnaja3 APN 16 4694445 missense probably damaging 1.00
IGL01531:Dnaja3 APN 16 4694404 missense probably damaging 1.00
IGL01607:Dnaja3 APN 16 4693395 missense probably damaging 1.00
IGL01981:Dnaja3 APN 16 4701169 missense probably damaging 1.00
IGL02312:Dnaja3 APN 16 4694436 missense probably benign 0.02
IGL02473:Dnaja3 APN 16 4701240 nonsense probably null
IGL02795:Dnaja3 APN 16 4690073 splice site probably benign
R1334:Dnaja3 UTSW 16 4699794 missense probably damaging 1.00
R1700:Dnaja3 UTSW 16 4684165 missense probably null 0.02
R1733:Dnaja3 UTSW 16 4684165 missense probably null 0.02
R1854:Dnaja3 UTSW 16 4697269 missense probably damaging 1.00
R2330:Dnaja3 UTSW 16 4690016 missense probably benign 0.01
R4232:Dnaja3 UTSW 16 4699871 missense possibly damaging 0.80
R4357:Dnaja3 UTSW 16 4699867 missense probably damaging 0.96
R4434:Dnaja3 UTSW 16 4689995 nonsense probably null
R5072:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5073:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5074:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5160:Dnaja3 UTSW 16 4684288 missense probably benign 0.01
R5347:Dnaja3 UTSW 16 4694482 missense possibly damaging 0.78
R7106:Dnaja3 UTSW 16 4705934 missense probably benign 0.13
R7214:Dnaja3 UTSW 16 4701182 missense possibly damaging 0.61
R7673:Dnaja3 UTSW 16 4694464 missense probably benign 0.25
R8069:Dnaja3 UTSW 16 4684267 missense probably benign
R8154:Dnaja3 UTSW 16 4699876 missense possibly damaging 0.53
R8477:Dnaja3 UTSW 16 4687348 missense probably null 0.68
R8811:Dnaja3 UTSW 16 4696519 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CAAAATGGCTGCGTGGTGTTC -3'
(R):5'- TTCGGAGCGTTTCAACACC -3'

Sequencing Primer
(F):5'- TGTTCCCCACGCTGGTTGAG -3'
(R):5'- TTCTGGGTAGCCAGCACCTTG -3'
Posted On2016-07-06