Incidental Mutation 'R5251:Camk4'
ID399067
Institutional Source Beutler Lab
Gene Symbol Camk4
Ensembl Gene ENSMUSG00000038128
Gene Namecalcium/calmodulin-dependent protein kinase IV
SynonymsD18Bwg0362e, CaMKIV/Gr, CaMKIV, Ca2+/calmodulin-dependent protein kinase type IV/Gr, A430110E23Rik
MMRRC Submission 042822-MU
Accession Numbers

Genbank: NM_009793; MGI: 88258

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location32939041-33195767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33184879 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 363 (D363G)
Ref Sequence ENSEMBL: ENSMUSP00000046539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042868]
Predicted Effect probably benign
Transcript: ENSMUST00000042868
AA Change: D363G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046539
Gene: ENSMUSG00000038128
AA Change: D363G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
S_TKc 42 296 8.7e-106 SMART
low complexity region 318 344 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for different targeted mutations show variable phenotypes, including reduced viability, male and/or female sterility, and mild to severe neurological and spatial memory disorders. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(3) Targeted, other(1)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Camk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
7510:Camk4 UTSW 18 33156839 missense probably null 0.99
R0244:Camk4 UTSW 18 33179625 critical splice donor site probably null
R0408:Camk4 UTSW 18 33129792 missense probably damaging 1.00
R0744:Camk4 UTSW 18 32939454 missense unknown
R0836:Camk4 UTSW 18 32939454 missense unknown
R0903:Camk4 UTSW 18 33182330 missense probably benign 0.08
R1449:Camk4 UTSW 18 32939475 missense probably damaging 0.99
R1456:Camk4 UTSW 18 33129843 splice site probably benign
R1677:Camk4 UTSW 18 33176222 missense probably damaging 1.00
R1733:Camk4 UTSW 18 33078021 missense possibly damaging 0.54
R1909:Camk4 UTSW 18 33158816 splice site probably null
R2186:Camk4 UTSW 18 33182341 missense probably damaging 0.99
R2291:Camk4 UTSW 18 33107943 critical splice donor site probably null
R3874:Camk4 UTSW 18 33158854 missense possibly damaging 0.70
R3968:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3969:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3970:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R4858:Camk4 UTSW 18 33176213 missense probably damaging 0.98
R5343:Camk4 UTSW 18 33078069 missense probably damaging 0.99
R5972:Camk4 UTSW 18 33107926 missense probably damaging 1.00
R6155:Camk4 UTSW 18 32939447 missense unknown
R6728:Camk4 UTSW 18 33184939 missense probably benign
R7088:Camk4 UTSW 18 32939531 missense probably benign 0.02
R7135:Camk4 UTSW 18 33107943 critical splice donor site probably null
R7372:Camk4 UTSW 18 33185125 missense probably benign 0.34
R7490:Camk4 UTSW 18 32939545 critical splice donor site probably null
R7525:Camk4 UTSW 18 33185032 missense probably benign 0.04
R7890:Camk4 UTSW 18 33185005 missense probably benign 0.01
R8446:Camk4 UTSW 18 33156757 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATTGGCAATTTCCCCTGG -3'
(R):5'- CAGTCATGGGGTCCATTTCTTC -3'

Sequencing Primer
(F):5'- GGGAACACCATTTAGTACTTTTCTC -3'
(R):5'- TGGGTCATCTGTTTCCAGC -3'
Posted On2016-07-06