Mutagenetix > Incidental Mutations

Incidental Mutation 'R0454:Prkca'

39907

Institutional Source

Beutler Lab

Gene Symbol

Prkca

Ensembl Gene

ENSMUSG00000050965

Gene Name

protein kinase C, alpha

Synonyms

Pkca

MMRRC Submission

038654-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.668) question?

Stock #

R0454 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107933387-108343928 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107978280 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 69 (V69A)

Ref Sequence

ENSEMBL: ENSMUSP00000097875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059595] [ENSMUST00000100302]

Predicted Effect

probably benign
Transcript: ENSMUST00000059595
AA Change: V493A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000062392
Gene: ENSMUSG00000050965
AA Change: V493A

Domain	Start	End	E-Value	Type
C1	37	86	3.09e-16	SMART
C1	102	151	1.33e-15	SMART
C2	172	275	7.66e-26	SMART
S_TKc	339	597	8.85e-98	SMART
S_TK_X	598	660	1.58e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100302
AA Change: V69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097875
Gene: ENSMUSG00000050965
AA Change: V69A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	2	173	9.3e-44	PFAM
Pfam:Pkinase_Tyr	3	159	3.7e-25	PFAM
S_TK_X	174	236	1.58e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134910

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show no overt macroscopic abnormalities, however examination of one line revealed increased cardiac muscle contractility and protection against heart failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	A	G	5: 118,255,821	E88G	possibly damaging	Het
4930447F04Rik	T	C	X: 66,303,668	E91G	unknown	Het
Acot1	A	G	12: 84,017,339	Q407R	probably benign	Het
Adcy10	T	A	1: 165,570,728	Y1465N	probably damaging	Het
Ahsa2	T	A	11: 23,490,702	I249F	probably damaging	Het
Arhgap10	T	C	8: 77,250,965	N721S	probably damaging	Het
Arrdc4	T	G	7: 68,741,871	E216A	probably damaging	Het
Axin1	T	C	17: 26,173,663	V306A	probably benign	Het
BC005561	T	G	5: 104,518,211	S200A	probably benign	Het
Cct3	T	C	3: 88,302,866		probably null	Het
Cfap58	G	A	19: 47,974,680		probably null	Het
Chd9	T	C	8: 90,973,231	S49P	possibly damaging	Het
Clcn2	C	A	16: 20,710,428		probably null	Het
Col26a1	T	C	5: 136,754,193	N286D	probably benign	Het
Cpt1b	T	A	15: 89,424,393	I111F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,087	I30N	probably damaging	Het
Ddc	T	G	11: 11,880,587	D19A	possibly damaging	Het
Depdc1a	T	A	3: 159,516,900		probably null	Het
Evc2	T	A	5: 37,417,484	C1028S	possibly damaging	Het
Fam228a	T	C	12: 4,731,457	E134G	probably damaging	Het
Fasl	T	C	1: 161,787,954	E111G	probably benign	Het
Fbxw10	A	G	11: 62,876,738	N800S	possibly damaging	Het
Fras1	T	C	5: 96,762,665	S3318P	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gad1	T	A	2: 70,579,201	M212K	probably damaging	Het
Gm17455	T	G	10: 60,402,973	S6A	probably benign	Het
Grm5	T	C	7: 88,130,789	S1146P	probably damaging	Het
Gsn	T	C	2: 35,304,639	L649P	probably damaging	Het
H2-DMb1	A	G	17: 34,155,711	T112A	probably benign	Het
Hcn3	T	A	3: 89,152,894	I148F	probably damaging	Het
Hdac10	T	C	15: 89,125,758		probably null	Het
Hk3	C	A	13: 55,008,705	D619Y	probably damaging	Het
Ifi44	T	A	3: 151,745,497	R272S	possibly damaging	Het
Il1rap	A	C	16: 26,698,875	D275A	probably damaging	Het
Itgam	A	T	7: 128,107,980	N660I	probably benign	Het
Itpr3	T	C	17: 27,113,819	M1853T	probably benign	Het
Lrmp	A	G	6: 145,167,984	R293G	possibly damaging	Het
Lrrc8c	A	C	5: 105,607,099	K247Q	probably damaging	Het
Map3k21	T	C	8: 125,942,119	S815P	probably benign	Het
Mast4	A	G	13: 102,751,560	S1114P	probably damaging	Het
Myh8	C	T	11: 67,303,765	Q1601*	probably null	Het
Nhlrc2	A	G	19: 56,570,527	D148G	probably damaging	Het
Nos1	T	A	5: 117,943,320	S1196T	probably benign	Het
Nsmaf	C	T	4: 6,424,874		probably null	Het
Obscn	T	C	11: 58,999,623	D7361G	unknown	Het
Olfr1350	C	T	7: 6,570,360	A123V	probably damaging	Het
Olfr600	C	A	7: 103,346,878	A17S	probably benign	Het
Olfr721-ps1	T	C	14: 14,407,777	V183A	probably damaging	Het
Pank3	T	G	11: 35,777,709	M175R	probably benign	Het
Papolg	A	G	11: 23,879,868		probably null	Het
Pcdhb21	G	A	18: 37,514,513	D232N	probably damaging	Het
Pcdhb22	T	C	18: 37,518,872	F131S	probably damaging	Het
Pik3r6	G	A	11: 68,528,782	A140T	possibly damaging	Het
Pinlyp	T	C	7: 24,542,522	T87A	possibly damaging	Het
Pld1	T	C	3: 28,124,575	S873P	probably damaging	Het
Pld5	T	A	1: 176,274,729	Y49F	probably benign	Het
Polq	T	C	16: 37,034,890	V449A	probably damaging	Het
Ptk6	A	G	2: 181,202,282	S75P	possibly damaging	Het
Ptprq	G	A	10: 107,582,530	Q1662*	probably null	Het
Ptprt	C	A	2: 161,553,822	A1144S	probably damaging	Het
Rrm1	T	A	7: 102,466,926	W684R	probably damaging	Het
Ryr1	T	A	7: 29,036,075	M4093L	probably damaging	Het
Scnn1a	C	T	6: 125,322,226	L90F	probably damaging	Het
Slc25a19	G	T	11: 115,617,597	Y188*	probably null	Het
Slc31a1	C	T	4: 62,385,629		probably benign	Het
Slc5a11	C	G	7: 123,265,235	S351R	possibly damaging	Het
Slc6a17	A	G	3: 107,476,867	L387P	probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Spam1	T	A	6: 24,797,838	L331Q	probably damaging	Het
Spata32	A	G	11: 103,209,299	W127R	probably damaging	Het
Spta1	T	G	1: 174,213,942	I1324S	probably damaging	Het
St6galnac4	A	G	2: 32,594,318	Y176C	probably damaging	Het
Stk10	A	G	11: 32,596,724	E327G	probably damaging	Het
Stxbp5l	T	A	16: 37,134,284	Y912F	possibly damaging	Het
Tchp	G	A	5: 114,720,182	E459K	probably benign	Het
Terf2	C	T	8: 107,096,210	W100*	probably null	Het
Thrsp	T	C	7: 97,417,427	N26S	probably damaging	Het
Tln1	C	A	4: 43,553,504	R297L	probably benign	Het
Tmeff2	C	A	1: 50,928,075	T43N	possibly damaging	Het
Tmx1	C	T	12: 70,453,173	A2V	possibly damaging	Het
Tnks1bp1	T	A	2: 85,072,137	L1053Q	probably damaging	Het
Trmt10b	A	T	4: 45,304,286	K107N	probably damaging	Het
Trpa1	A	T	1: 14,885,748		probably null	Het
Trrap	A	G	5: 144,846,477	K3371R	probably damaging	Het
Tuba3b	G	A	6: 145,618,269	V14I	probably benign	Het
Usp19	T	C	9: 108,494,240		probably null	Het
Usp28	C	A	9: 49,039,101	D615E	possibly damaging	Het
Utp20	T	C	10: 88,822,069	D43G	probably benign	Het
Vmn1r58	T	G	7: 5,410,998	K78Q	possibly damaging	Het
Vmn2r10	T	C	5: 109,003,461	M96V	probably benign	Het
Wdr90	T	C	17: 25,860,049	E273G	probably damaging	Het
Xpc	C	T	6: 91,491,226	A860T	probably benign	Het
Zscan21	T	C	5: 138,133,603	I463T	possibly damaging	Het

Other mutations in Prkca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Prkca	APN	11	108343508	missense	probably benign	0.10
IGL00903:Prkca	APN	11	107983974	missense	probably damaging	1.00
IGL01385:Prkca	APN	11	107978352	missense	probably damaging	1.00
IGL01396:Prkca	APN	11	108014322	missense	possibly damaging	0.59
IGL01480:Prkca	APN	11	108192201	missense	probably damaging	1.00
IGL01480:Prkca	APN	11	107986289	missense	possibly damaging	0.93
IGL01516:Prkca	APN	11	107961602	missense	probably null	1.00
IGL01553:Prkca	APN	11	108057834	missense	probably benign	0.15
IGL02975:Prkca	APN	11	108340677	nonsense	probably null
IGL03402:Prkca	APN	11	108340663	missense	probably benign	0.20
R0101:Prkca	UTSW	11	108057800	missense	probably damaging	1.00
R0279:Prkca	UTSW	11	108054111	splice site	probably benign
R0513:Prkca	UTSW	11	108014376	missense	possibly damaging	0.82
R0711:Prkca	UTSW	11	107981654	missense	probably benign	0.16
R0894:Prkca	UTSW	11	108012692	missense	possibly damaging	0.66
R0966:Prkca	UTSW	11	108014284	missense	possibly damaging	0.56
R1432:Prkca	UTSW	11	107939520	missense	probably benign	0.27
R1518:Prkca	UTSW	11	107978316	missense	probably damaging	1.00
R1667:Prkca	UTSW	11	107983946	missense	probably damaging	1.00
R1795:Prkca	UTSW	11	108012692	missense	possibly damaging	0.66
R1909:Prkca	UTSW	11	107939612	missense	possibly damaging	0.68
R1932:Prkca	UTSW	11	108192149	missense	probably benign	0.13
R2509:Prkca	UTSW	11	107979206	missense	probably damaging	1.00
R3889:Prkca	UTSW	11	107979240	missense	probably damaging	1.00
R4018:Prkca	UTSW	11	107939602	missense	probably damaging	1.00
R4684:Prkca	UTSW	11	107961608	missense	probably damaging	0.99
R5132:Prkca	UTSW	11	108192117	splice site	probably benign
R5298:Prkca	UTSW	11	108012684	missense	probably damaging	0.98
R5546:Prkca	UTSW	11	108053980	missense	probably benign	0.14
R5558:Prkca	UTSW	11	107981647	missense	probably damaging	1.00
R5616:Prkca	UTSW	11	107978343	missense	possibly damaging	0.85
R5626:Prkca	UTSW	11	108057815	missense	possibly damaging	0.94
R5931:Prkca	UTSW	11	108014310	missense	probably benign	0.01
R6061:Prkca	UTSW	11	108057845	missense	probably benign	0.03
R7125:Prkca	UTSW	11	107984022	missense	probably damaging	1.00
R7283:Prkca	UTSW	11	108340645	critical splice donor site	probably null
R7329:Prkca	UTSW	11	108014277	missense	possibly damaging	0.73
R7510:Prkca	UTSW	11	107983994	missense	possibly damaging	0.89
R7670:Prkca	UTSW	11	108014344	missense	probably damaging	0.98
R7890:Prkca	UTSW	11	108012684	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TACCACATGGCTGCCTCACGAATAC -3'
(R):5'- TGTCACTGAGACAAGCTAGGCAAAC -3'

Sequencing Primer
(F):5'- TGCCTCACGAATACACGGG -3'
(R):5'- GCTAGGCAAACGTCCTGATATG -3'

Posted On

2013-05-23