Incidental Mutation 'R5252:Serpinc1'
ID399074
Institutional Source Beutler Lab
Gene Symbol Serpinc1
Ensembl Gene ENSMUSG00000026715
Gene Nameserine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1
SynonymsAt3, At-3, antithrombin, ATIII
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location160978585-161005863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160989621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 95 (F95S)
Ref Sequence ENSEMBL: ENSMUSP00000141864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064725] [ENSMUST00000191936] [ENSMUST00000194592] [ENSMUST00000195438] [ENSMUST00000195760]
Predicted Effect probably damaging
Transcript: ENSMUST00000064725
AA Change: F95S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068971
Gene: ENSMUSG00000026715
AA Change: F95S

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
SERPIN 93 462 5.55e-173 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191936
SMART Domains Protein: ENSMUSP00000142122
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
Pfam:Serpin 1 91 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194455
Predicted Effect possibly damaging
Transcript: ENSMUST00000194592
AA Change: F95S

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141556
Gene: ENSMUSG00000026715
AA Change: F95S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SERPIN 93 286 8.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194777
Predicted Effect probably benign
Transcript: ENSMUST00000195438
SMART Domains Protein: ENSMUSP00000141834
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
Pfam:Serpin 1 97 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195760
AA Change: F95S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141864
Gene: ENSMUSG00000026715
AA Change: F95S

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Blast:SERPIN 32 107 5e-43 BLAST
PDB:2GD4|C 32 107 3e-43 PDB
SCOP:d1e05i_ 35 107 4e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. More than 120 mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit extensive subcutaneous hemorrhage, fibrin deposits in the myocardium and liver, and lethality by embryonic day 16.5. Heterozygotes challenged with lipopolysaccharide show increased fibrin deposits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Serpinc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Serpinc1 APN 1 160993400 missense probably damaging 1.00
IGL01923:Serpinc1 APN 1 160989546 missense probably damaging 0.98
IGL01987:Serpinc1 APN 1 160993407 missense probably damaging 1.00
IGL02272:Serpinc1 APN 1 160999992 missense probably damaging 1.00
IGL02574:Serpinc1 APN 1 161002459 missense probably benign 0.00
IGL02730:Serpinc1 APN 1 161000028 missense probably damaging 0.97
IGL02861:Serpinc1 APN 1 160999991 missense probably damaging 0.99
IGL03377:Serpinc1 APN 1 160993442 missense probably damaging 1.00
R0277:Serpinc1 UTSW 1 160989702 start codon destroyed probably null 1.00
R1294:Serpinc1 UTSW 1 160989641 missense probably damaging 0.98
R1368:Serpinc1 UTSW 1 160993524 missense probably damaging 1.00
R1433:Serpinc1 UTSW 1 160993404 missense probably damaging 0.97
R1436:Serpinc1 UTSW 1 160993411 missense possibly damaging 0.63
R1480:Serpinc1 UTSW 1 160995319 missense probably benign 0.00
R1703:Serpinc1 UTSW 1 160993517 missense probably damaging 1.00
R1775:Serpinc1 UTSW 1 160989647 missense probably benign 0.07
R2007:Serpinc1 UTSW 1 160993540 missense probably benign 0.05
R3757:Serpinc1 UTSW 1 161002365 missense probably benign 0.00
R5134:Serpinc1 UTSW 1 160997570 unclassified probably null
R7033:Serpinc1 UTSW 1 160997521 missense probably benign 0.04
R7254:Serpinc1 UTSW 1 160993618 missense probably benign 0.01
R7262:Serpinc1 UTSW 1 160989659 missense probably damaging 1.00
R7429:Serpinc1 UTSW 1 160995441 missense probably benign 0.03
Z1176:Serpinc1 UTSW 1 160989456 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTGGACGACATCTGCATAGC -3'
(R):5'- ATCCCCTAGACGAGCAGATG -3'

Sequencing Primer
(F):5'- CGAAGCCCCGAGACATC -3'
(R):5'- AAGCAGTGGAGATGCTCA -3'
Posted On2016-07-06