Incidental Mutation 'R5252:Olfr1217'
ID399086
Institutional Source Beutler Lab
Gene Symbol Olfr1217
Ensembl Gene ENSMUSG00000101391
Gene Nameolfactory receptor 1217
SynonymsMOR233-4, GA_x6K02T2Q125-50504545-50503631
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89021336-89032065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89023254 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 250 (F250I)
Ref Sequence ENSEMBL: ENSMUSP00000149931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099799] [ENSMUST00000213669] [ENSMUST00000214022] [ENSMUST00000216000] [ENSMUST00000216592] [ENSMUST00000217000]
Predicted Effect probably damaging
Transcript: ENSMUST00000099799
AA Change: F250I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097387
Gene: ENSMUSG00000101391
AA Change: F250I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-48 PFAM
Pfam:7tm_1 39 286 6.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213669
AA Change: F250I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214022
AA Change: F250I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216000
Predicted Effect probably damaging
Transcript: ENSMUST00000216592
AA Change: F250I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000217000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Olfr1217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr1217 APN 2 89023175 missense probably benign 0.00
IGL02034:Olfr1217 APN 2 89023671 missense probably benign 0.07
IGL03328:Olfr1217 APN 2 89023855 nonsense probably null
R0153:Olfr1217 UTSW 2 89023196 missense probably benign 0.00
R0414:Olfr1217 UTSW 2 89023146 missense probably damaging 1.00
R0544:Olfr1217 UTSW 2 89023826 missense probably damaging 1.00
R1994:Olfr1217 UTSW 2 89023143 missense probably damaging 1.00
R2217:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3738:Olfr1217 UTSW 2 89023610 missense probably damaging 1.00
R3794:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3808:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3809:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R5448:Olfr1217 UTSW 2 89023501 missense probably benign
R7524:Olfr1217 UTSW 2 89023971 missense probably benign 0.01
R8031:Olfr1217 UTSW 2 89023628 missense not run
Z1176:Olfr1217 UTSW 2 89023795 missense not run
Z1176:Olfr1217 UTSW 2 89023896 missense not run
Z1177:Olfr1217 UTSW 2 89023440 missense not run
Predicted Primers PCR Primer
(F):5'- CCTCTCCACTGAACTGGATAC -3'
(R):5'- TTGCCTGCACAGACACACA -3'

Sequencing Primer
(F):5'- AGGCCATAAGTTGAGGCTCATTCC -3'
(R):5'- CAGACACACACATTTATGTCCTTTTG -3'
Posted On2016-07-06