Incidental Mutation 'R5252:Trp53bp1'
ID399088
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121243983 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 429 (S429P)
Ref Sequence ENSEMBL: ENSMUSP00000106277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]
Predicted Effect probably benign
Transcript: ENSMUST00000110647
AA Change: S429P

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: S429P

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110648
AA Change: S429P

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: S429P

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129752
Predicted Effect probably benign
Transcript: ENSMUST00000131245
AA Change: S429P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: S429P

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTAACCTCCATCTACACATGCA -3'
(R):5'- GGAGCATGAGTAATATCGGTGAG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- AGCATGAGTAATATCGGTGAGTGCTG -3'
Posted On2016-07-06