Incidental Mutation 'R5252:Fam46c'
ID399091
Institutional Source Beutler Lab
Gene Symbol Fam46c
Ensembl Gene ENSMUSG00000044468
Gene Namefamily with sequence similarity 46, member C
Synonyms4930431B09Rik
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100451628-100489324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100472708 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 244 (L244P)
Ref Sequence ENSEMBL: ENSMUSP00000056872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061455]
Predicted Effect probably damaging
Transcript: ENSMUST00000061455
AA Change: L244P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056872
Gene: ENSMUSG00000044468
AA Change: L244P

DomainStartEndE-ValueType
DUF1693 17 336 3.33e-241 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139833
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypochromic microcytic anemia and decreased B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Fam46c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fam46c APN 3 100473356 missense probably damaging 0.96
IGL01314:Fam46c APN 3 100473174 missense probably benign 0.18
IGL01409:Fam46c APN 3 100473169 missense probably damaging 1.00
IGL01817:Fam46c APN 3 100472855 missense probably damaging 1.00
IGL01863:Fam46c APN 3 100472664 missense probably benign 0.05
IGL01992:Fam46c APN 3 100472630 missense probably damaging 1.00
IGL02436:Fam46c APN 3 100472507 missense probably benign 0.43
R0111:Fam46c UTSW 3 100472786 missense probably damaging 1.00
R0529:Fam46c UTSW 3 100472370 missense probably benign 0.36
R1196:Fam46c UTSW 3 100473000 missense possibly damaging 0.73
R1242:Fam46c UTSW 3 100472876 missense probably damaging 1.00
R4671:Fam46c UTSW 3 100473199 missense probably benign 0.44
R6730:Fam46c UTSW 3 100472957 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTGCGGAGAATCATGAGGTAGTC -3'
(R):5'- GTTCAGCGTGGACTCTTTCC -3'

Sequencing Primer
(F):5'- AGAATCATGAGGTAGTCGTACTTGC -3'
(R):5'- GGACTCTTTCCAGATCATCCTAG -3'
Posted On2016-07-06