Incidental Mutation 'R5252:Lin54'
ID399097
Institutional Source Beutler Lab
Gene Symbol Lin54
Ensembl Gene ENSMUSG00000035310
Gene Namelin-54 homolog (C. elegans)
Synonyms
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100441918-100500639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100480204 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 47 (V47I)
Ref Sequence ENSEMBL: ENSMUSP00000121137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046154] [ENSMUST00000123572] [ENSMUST00000137750] [ENSMUST00000139234] [ENSMUST00000144030] [ENSMUST00000149714] [ENSMUST00000152387] [ENSMUST00000154921]
Predicted Effect probably benign
Transcript: ENSMUST00000046154
AA Change: V268I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041374
Gene: ENSMUSG00000035310
AA Change: V268I

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123572
AA Change: V268I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123425
Gene: ENSMUSG00000035310
AA Change: V268I

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134439
AA Change: V130I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000137750
AA Change: V47I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120644
Gene: ENSMUSG00000035310
AA Change: V47I

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139234
SMART Domains Protein: ENSMUSP00000119322
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 218 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144030
AA Change: V47I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144716
Predicted Effect probably benign
Transcript: ENSMUST00000149714
AA Change: V47I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123544
Gene: ENSMUSG00000035310
AA Change: V47I

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152387
SMART Domains Protein: ENSMUSP00000121902
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 218 231 N/A INTRINSIC
low complexity region 275 293 N/A INTRINSIC
low complexity region 315 330 N/A INTRINSIC
CXC 431 471 3.06e-15 SMART
CXC 505 546 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154921
AA Change: V47I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121137
Gene: ENSMUSG00000035310
AA Change: V47I

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIN54 is a component of the LIN, or DREAM, complex, an essential regulator of cell cycle genes (Schmit et al., 2009 [PubMed 19725879]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Lin54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Lin54 APN 5 100485607 missense probably benign 0.03
IGL01356:Lin54 APN 5 100454017 missense probably damaging 0.98
IGL02931:Lin54 APN 5 100480321 missense possibly damaging 0.93
IGL03089:Lin54 APN 5 100450993 missense probably damaging 1.00
IGL03095:Lin54 APN 5 100454478 missense probably damaging 0.99
IGL03202:Lin54 APN 5 100475814 missense possibly damaging 0.92
R0505:Lin54 UTSW 5 100452293 missense probably damaging 0.98
R1138:Lin54 UTSW 5 100444134 missense probably damaging 0.98
R1540:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R1719:Lin54 UTSW 5 100485249 missense possibly damaging 0.91
R1991:Lin54 UTSW 5 100485801 critical splice donor site probably null
R2698:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R3738:Lin54 UTSW 5 100459806 splice site probably benign
R4238:Lin54 UTSW 5 100475744 missense possibly damaging 0.45
R4424:Lin54 UTSW 5 100446560 missense probably damaging 0.98
R4529:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4530:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4531:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4532:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4533:Lin54 UTSW 5 100485403 missense possibly damaging 0.79
R4665:Lin54 UTSW 5 100453084 missense possibly damaging 0.92
R4784:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R4785:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R5265:Lin54 UTSW 5 100485519 missense probably damaging 1.00
R6545:Lin54 UTSW 5 100485137 unclassified probably null
R7150:Lin54 UTSW 5 100485300 missense possibly damaging 0.74
R7544:Lin54 UTSW 5 100485270 missense possibly damaging 0.84
X0025:Lin54 UTSW 5 100454443 missense probably benign 0.11
X0026:Lin54 UTSW 5 100450999 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACTGGACTATGATTATTTTGTGTGT -3'
(R):5'- TCATTTTACTGCACACATGTTTTG -3'

Sequencing Primer
(F):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- GTTTTGTGGAAACATATCTTCATGG -3'
Posted On2016-07-06