Incidental Mutation 'R5252:Evi5'
ID399099
Institutional Source Beutler Lab
Gene Symbol Evi5
Ensembl Gene ENSMUSG00000011831
Gene Nameecotropic viral integration site 5
SynonymsNB4S
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107744795-107875107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107795752 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 592 (T592A)
Ref Sequence ENSEMBL: ENSMUSP00000114845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112642] [ENSMUST00000128723]
Predicted Effect probably benign
Transcript: ENSMUST00000112642
AA Change: T576A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108261
Gene: ENSMUSG00000011831
AA Change: T576A

DomainStartEndE-ValueType
low complexity region 51 80 N/A INTRINSIC
Blast:TBC 81 157 2e-16 BLAST
TBC 160 371 7.92e-91 SMART
internal_repeat_1 450 477 8.83e-6 PROSPERO
internal_repeat_1 494 521 8.83e-6 PROSPERO
coiled coil region 555 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128723
AA Change: T592A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114845
Gene: ENSMUSG00000011831
AA Change: T592A

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 2e-16 BLAST
TBC 116 327 7.92e-91 SMART
internal_repeat_1 466 493 2.66e-6 PROSPERO
internal_repeat_1 510 537 2.66e-6 PROSPERO
coiled coil region 571 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155897
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Evi5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Evi5 APN 5 107815611 missense probably benign 0.05
IGL01458:Evi5 APN 5 107815647 missense probably damaging 1.00
IGL01615:Evi5 APN 5 107764707 missense probably damaging 1.00
IGL01939:Evi5 APN 5 107816924 unclassified probably benign
IGL02170:Evi5 APN 5 107821884 missense probably benign 0.45
IGL02539:Evi5 APN 5 107815665 missense probably benign 0.09
IGL02655:Evi5 APN 5 107813580 missense probably benign 0.36
IGL03040:Evi5 APN 5 107821806 missense probably damaging 1.00
IGL03058:Evi5 APN 5 107748151 missense probably damaging 0.98
R0125:Evi5 UTSW 5 107795772 missense probably benign 0.06
R0172:Evi5 UTSW 5 107790462 missense probably benign
R0334:Evi5 UTSW 5 107820535 missense probably damaging 0.97
R0335:Evi5 UTSW 5 107812411 missense probably benign 0.06
R0526:Evi5 UTSW 5 107821748 missense probably benign 0.44
R0579:Evi5 UTSW 5 107821709 missense probably benign 0.36
R0585:Evi5 UTSW 5 107813536 unclassified probably benign
R1123:Evi5 UTSW 5 107820578 missense probably benign 0.02
R1618:Evi5 UTSW 5 107799118 splice site probably benign
R1699:Evi5 UTSW 5 107818920 missense probably damaging 1.00
R1772:Evi5 UTSW 5 107795841 missense probably benign 0.32
R1969:Evi5 UTSW 5 107748364 missense probably benign 0.04
R1977:Evi5 UTSW 5 107799139 nonsense probably null
R2010:Evi5 UTSW 5 107813545 critical splice donor site probably null
R3736:Evi5 UTSW 5 107818983 missense probably damaging 0.98
R5047:Evi5 UTSW 5 107821874 missense probably damaging 1.00
R5350:Evi5 UTSW 5 107815678 missense probably benign 0.08
R5552:Evi5 UTSW 5 107818989 missense probably damaging 1.00
R5594:Evi5 UTSW 5 107820451 missense possibly damaging 0.84
R5895:Evi5 UTSW 5 107820436 missense probably damaging 1.00
R6334:Evi5 UTSW 5 107820521 nonsense probably null
R6364:Evi5 UTSW 5 107842113 missense probably damaging 1.00
R6838:Evi5 UTSW 5 107842161 missense possibly damaging 0.94
R6861:Evi5 UTSW 5 107748318 missense probably benign 0.00
R7032:Evi5 UTSW 5 107788281 missense probably benign 0.14
X0018:Evi5 UTSW 5 107818887 critical splice donor site probably null
X0027:Evi5 UTSW 5 107764762 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGATTACACCACCGTGAAC -3'
(R):5'- GTGCTCTGTAAAGTTTGTTCATCC -3'

Sequencing Primer
(F):5'- GGCATGGCATTCAAACTTCG -3'
(R):5'- ATCCTCTATAGAGTACTTGTTGCG -3'
Posted On2016-07-06