Incidental Mutation 'R5175:Or4k47'
ID 399101
Institutional Source Beutler Lab
Gene Symbol Or4k47
Ensembl Gene ENSMUSG00000094858
Gene Name olfactory receptor family 4 subfamily K member 47
Synonyms GA_x6K02T2Q125-72673494-72672556, Olfr1297, MOR248-4
MMRRC Submission 042755-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R5175 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111451479-111452417 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111451771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 216 (I216N)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000207283] [ENSMUST00000213398]
AlphaFold Q8VGE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000099612
AA Change: I216N

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: I216N

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207283
AA Change: I216N
Predicted Effect possibly damaging
Transcript: ENSMUST00000213398
AA Change: I216N

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,030,114 (GRCm39) M215R probably benign Het
Ago2 A T 15: 72,996,067 (GRCm39) I354K possibly damaging Het
Angel2 T A 1: 190,673,081 (GRCm39) C72* probably null Het
Ank2 T A 3: 126,797,673 (GRCm39) H679L probably damaging Het
Anks1 A T 17: 28,261,562 (GRCm39) Q694L probably damaging Het
Aox3 C T 1: 58,211,487 (GRCm39) P1015S probably benign Het
Arhgap35 C A 7: 16,296,524 (GRCm39) R847L probably damaging Het
Bag4 C A 8: 26,258,379 (GRCm39) C316F probably damaging Het
Camkv T A 9: 107,824,581 (GRCm39) I258N probably damaging Het
Cpt1c G A 7: 44,620,781 (GRCm39) A28V probably damaging Het
Cyp2j13 A T 4: 95,956,452 (GRCm39) M219K possibly damaging Het
Dclk1 G T 3: 55,154,648 (GRCm39) R26L possibly damaging Het
Diras2 A T 13: 52,662,007 (GRCm39) I100N probably damaging Het
Dnah5 T A 15: 28,448,550 (GRCm39) N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 (GRCm38) K55* probably null Het
Dusp6 A G 10: 99,099,864 (GRCm39) D104G possibly damaging Het
Eif5b A G 1: 38,084,468 (GRCm39) T819A probably damaging Het
Elfn2 A T 15: 78,558,073 (GRCm39) L158H probably damaging Het
Erp44 T C 4: 48,196,823 (GRCm39) T367A probably benign Het
Fasn A T 11: 120,707,195 (GRCm39) D843E probably benign Het
Fbxw25 T C 9: 109,493,631 (GRCm39) Y20C probably damaging Het
Fer1l6 G A 15: 58,422,126 (GRCm39) G108E probably damaging Het
Fndc7 C T 3: 108,776,482 (GRCm39) V520I probably benign Het
Gm17019 A G 5: 15,082,817 (GRCm39) W46R possibly damaging Het
Gorab G T 1: 163,214,214 (GRCm39) Q239K probably damaging Het
Gsdma2 A G 11: 98,543,438 (GRCm39) T76A probably benign Het
Hnrnpll A C 17: 80,341,499 (GRCm39) C513W possibly damaging Het
Ifrd2 T C 9: 107,467,824 (GRCm39) L170P probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnma1 A G 14: 23,386,106 (GRCm39) probably null Het
Kcnn3 T C 3: 89,516,746 (GRCm39) F385S probably damaging Het
Kif18a T G 2: 109,133,323 (GRCm39) probably null Het
Llgl2 A G 11: 115,741,547 (GRCm39) K559R probably damaging Het
Lrrc8a T C 2: 30,145,524 (GRCm39) C113R probably damaging Het
Mgat5 A G 1: 127,387,649 (GRCm39) N535S probably damaging Het
Myh15 T G 16: 48,889,789 (GRCm39) W127G possibly damaging Het
Npsr1 A G 9: 24,046,111 (GRCm39) R77G probably benign Het
Nub1 T A 5: 24,907,446 (GRCm39) S376R probably benign Het
Or14c44 T C 7: 86,062,254 (GRCm39) V228A probably benign Het
Or4d10c G A 19: 12,065,926 (GRCm39) P77S probably damaging Het
Or5al6 T C 2: 85,976,301 (GRCm39) Y259C probably damaging Het
Or9i2 G A 19: 13,815,680 (GRCm39) P286S probably damaging Het
Pcdh9 A G 14: 94,125,879 (GRCm39) L97P probably damaging Het
Pkn2 A G 3: 142,504,684 (GRCm39) Y831H probably damaging Het
Plcz1 T G 6: 139,985,389 (GRCm39) I51L possibly damaging Het
Plekhg1 T C 10: 3,915,516 (GRCm39) probably benign Het
Prdm9 A T 17: 15,777,713 (GRCm39) S124T probably benign Het
Prkag1 A C 15: 98,713,596 (GRCm39) V33G possibly damaging Het
Rab25 T A 3: 88,450,728 (GRCm39) Y57F possibly damaging Het
Rb1cc1 A G 1: 6,318,545 (GRCm39) I638V probably benign Het
Rest C A 5: 77,416,219 (GRCm39) D144E probably damaging Het
Rpa2 A G 4: 132,505,151 (GRCm39) D260G probably damaging Het
Sf3b3 A G 8: 111,560,467 (GRCm39) V425A probably benign Het
Sidt2 A T 9: 45,863,086 (GRCm39) M15K probably damaging Het
Slc22a17 A G 14: 55,144,748 (GRCm39) L555P probably damaging Het
Smoc2 A G 17: 14,595,719 (GRCm39) D282G possibly damaging Het
Sorcs3 G A 19: 48,748,284 (GRCm39) probably null Het
Spmap2l C T 5: 77,164,317 (GRCm39) P107S probably benign Het
Srcin1 A G 11: 97,464,703 (GRCm39) W15R probably damaging Het
Stra6l A G 4: 45,870,860 (GRCm39) T259A probably benign Het
Ube3a T C 7: 58,938,465 (GRCm39) F741S probably damaging Het
Vasp C A 7: 18,998,594 (GRCm39) M54I probably benign Het
Vmn1r174 A T 7: 23,454,153 (GRCm39) H273L probably benign Het
Vmn2r50 T A 7: 9,771,644 (GRCm39) I686F probably damaging Het
Vmn2r76 T C 7: 85,877,915 (GRCm39) E494G probably benign Het
Zfp788 A G 7: 41,298,753 (GRCm39) E443G probably damaging Het
Other mutations in Or4k47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Or4k47 APN 2 111,451,685 (GRCm39) missense probably damaging 1.00
IGL01305:Or4k47 APN 2 111,451,546 (GRCm39) missense probably damaging 1.00
IGL01903:Or4k47 APN 2 111,452,003 (GRCm39) missense probably benign 0.01
IGL01984:Or4k47 APN 2 111,451,927 (GRCm39) missense probably benign 0.34
IGL03065:Or4k47 APN 2 111,451,535 (GRCm39) missense probably damaging 0.98
ANU22:Or4k47 UTSW 2 111,451,546 (GRCm39) missense probably damaging 1.00
R0313:Or4k47 UTSW 2 111,451,945 (GRCm39) missense possibly damaging 0.77
R0615:Or4k47 UTSW 2 111,452,264 (GRCm39) missense possibly damaging 0.95
R1028:Or4k47 UTSW 2 111,451,870 (GRCm39) missense probably damaging 1.00
R1078:Or4k47 UTSW 2 111,451,690 (GRCm39) missense probably damaging 1.00
R1158:Or4k47 UTSW 2 111,452,086 (GRCm39) missense probably damaging 1.00
R1419:Or4k47 UTSW 2 111,451,640 (GRCm39) missense probably benign 0.05
R1980:Or4k47 UTSW 2 111,451,586 (GRCm39) missense probably benign 0.00
R1981:Or4k47 UTSW 2 111,451,586 (GRCm39) missense probably benign 0.00
R2044:Or4k47 UTSW 2 111,452,159 (GRCm39) missense probably benign 0.02
R2080:Or4k47 UTSW 2 111,452,084 (GRCm39) missense probably benign
R2170:Or4k47 UTSW 2 111,451,945 (GRCm39) missense possibly damaging 0.77
R4494:Or4k47 UTSW 2 111,451,493 (GRCm39) nonsense probably null
R4965:Or4k47 UTSW 2 111,451,879 (GRCm39) missense probably damaging 1.00
R5891:Or4k47 UTSW 2 111,451,778 (GRCm39) missense probably damaging 1.00
R6192:Or4k47 UTSW 2 111,451,520 (GRCm39) missense possibly damaging 0.91
R6383:Or4k47 UTSW 2 111,451,531 (GRCm39) missense probably benign 0.10
R6730:Or4k47 UTSW 2 111,452,080 (GRCm39) missense probably damaging 0.96
R7189:Or4k47 UTSW 2 111,451,538 (GRCm39) missense probably benign 0.03
R7193:Or4k47 UTSW 2 111,451,600 (GRCm39) missense probably damaging 1.00
R7199:Or4k47 UTSW 2 111,451,538 (GRCm39) missense probably benign 0.01
R7735:Or4k47 UTSW 2 111,451,819 (GRCm39) missense probably damaging 1.00
R8017:Or4k47 UTSW 2 111,452,412 (GRCm39) missense probably benign 0.00
R8019:Or4k47 UTSW 2 111,452,412 (GRCm39) missense probably benign 0.00
R8285:Or4k47 UTSW 2 111,452,390 (GRCm39) missense probably benign 0.32
R8419:Or4k47 UTSW 2 111,451,849 (GRCm39) missense probably benign 0.10
R9258:Or4k47 UTSW 2 111,452,329 (GRCm39) missense possibly damaging 0.77
X0063:Or4k47 UTSW 2 111,451,726 (GRCm39) missense probably benign 0.04
Z1176:Or4k47 UTSW 2 111,451,606 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGAAATTTGTCCAACCAGG -3'
(R):5'- ACTTGAAGAGGTGCACTGGG -3'

Sequencing Primer
(F):5'- TCCAACCAGGTGATATTTAGGG -3'
(R):5'- ACATGGTATAAGTCACGTGGTAGTGC -3'
Posted On 2016-07-06