Incidental Mutation 'R5175:Rab25'
ID399105
Institutional Source Beutler Lab
Gene Symbol Rab25
Ensembl Gene ENSMUSG00000008601
Gene NameRAB25, member RAS oncogene family
Synonyms
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88542029-88548300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88543421 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 57 (Y57F)
Ref Sequence ENSEMBL: ENSMUSP00000120505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008745] [ENSMUST00000131775] [ENSMUST00000172699]
Predicted Effect probably benign
Transcript: ENSMUST00000008745
AA Change: Y111F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000008745
Gene: ENSMUSG00000008601
AA Change: Y111F

DomainStartEndE-ValueType
RAB 13 176 2.1e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131775
AA Change: Y57F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120505
Gene: ENSMUSG00000008601
AA Change: Y57F

DomainStartEndE-ValueType
RAB 3 122 6.15e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149724
Predicted Effect probably benign
Transcript: ENSMUST00000172699
SMART Domains Protein: ENSMUSP00000134222
Gene: ENSMUSG00000074480

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
low complexity region 53 110 N/A INTRINSIC
KH 130 198 3.35e-9 SMART
KH 222 289 4.59e-16 SMART
low complexity region 406 415 N/A INTRINSIC
RING 469 508 1.39e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAS superfamily of small GTPases. The encoded protein is involved in membrane trafficking and cell survival. This gene has been found to be a tumor suppressor and an oncogene, depending on the context. Two variants, one protein-coding and the other not, have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: On a 129 background, virgin female homozygotes older than 10 months of age develop vaginal cancer while both male and female homozygotes develop distal esophageal stricture due to squamous cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Rab25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Rab25 APN 3 88545239 missense probably damaging 1.00
IGL02444:Rab25 APN 3 88542713 missense probably benign 0.24
IGL03098:Rab25 UTSW 3 88542260 missense probably damaging 1.00
R0165:Rab25 UTSW 3 88548055 missense probably benign 0.00
R1980:Rab25 UTSW 3 88543458 missense probably damaging 0.97
R6612:Rab25 UTSW 3 88543403 missense probably damaging 0.99
R7688:Rab25 UTSW 3 88544963 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACACATGGGTTCCCAAAGG -3'
(R):5'- CAGGCATTTAGCTTGGTGAC -3'

Sequencing Primer
(F):5'- CATGAGGGAAGACAGACCATCC -3'
(R):5'- CATTTAGCTTGGTGACTGTGCTCC -3'
Posted On2016-07-06