Incidental Mutation 'R5252:Olfr967'
ID399112
Institutional Source Beutler Lab
Gene Symbol Olfr967
Ensembl Gene ENSMUSG00000055820
Gene Nameolfactory receptor 967
SynonymsGA_x6K02T2PVTD-33447884-33448816, MOR171-30P
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39746249-39751493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39750488 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 34 (I34S)
Ref Sequence ENSEMBL: ENSMUSP00000150183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069561] [ENSMUST00000213358]
Predicted Effect probably damaging
Transcript: ENSMUST00000069561
AA Change: I34S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064201
Gene: ENSMUSG00000055820
AA Change: I34S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.6e-50 PFAM
Pfam:7tm_1 41 290 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213358
AA Change: I34S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Olfr967
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Olfr967 APN 9 39750491 missense probably damaging 0.99
IGL02900:Olfr967 APN 9 39750605 missense probably benign 0.01
R0099:Olfr967 UTSW 9 39750661 missense possibly damaging 0.95
R0586:Olfr967 UTSW 9 39751118 missense probably damaging 0.98
R0653:Olfr967 UTSW 9 39750638 missense probably benign 0.26
R0839:Olfr967 UTSW 9 39750391 missense probably benign
R1701:Olfr967 UTSW 9 39751069 missense probably damaging 1.00
R1744:Olfr967 UTSW 9 39750415 missense probably benign 0.33
R1902:Olfr967 UTSW 9 39750806 missense probably benign 0.01
R4696:Olfr967 UTSW 9 39750728 missense probably damaging 0.98
R5660:Olfr967 UTSW 9 39750767 missense probably damaging 1.00
R6272:Olfr967 UTSW 9 39750520 missense probably benign 0.39
R6976:Olfr967 UTSW 9 39751244 missense probably damaging 1.00
R7078:Olfr967 UTSW 9 39750491 missense possibly damaging 0.92
R7167:Olfr967 UTSW 9 39750569 missense probably damaging 0.96
R7701:Olfr967 UTSW 9 39751301 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTGCTTGACCTTGGTTTCAC -3'
(R):5'- GCTGAGTCATACATTCAGGGTAGG -3'

Sequencing Primer
(F):5'- CACACTTCCATATGTGATAGGACAGG -3'
(R):5'- GGAGATGATGTTCTTCACAGTCAC -3'
Posted On2016-07-06