Incidental Mutation 'R5175:Erp44'
ID399120
Institutional Source Beutler Lab
Gene Symbol Erp44
Ensembl Gene ENSMUSG00000028343
Gene Nameendoplasmic reticulum protein 44
Synonyms1110001E24Rik, Txndc4
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48193323-48279558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48196823 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 367 (T367A)
Ref Sequence ENSEMBL: ENSMUSP00000030028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030028]
Predicted Effect probably benign
Transcript: ENSMUST00000030028
AA Change: T367A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030028
Gene: ENSMUSG00000028343
AA Change: T367A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:Calsequestrin 29 205 6.4e-12 PFAM
Pfam:Thioredoxin 30 139 1.1e-23 PFAM
Pfam:Thioredoxin_6 167 350 8.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138743
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins. It has an inferred N-terminal signal peptide, a catalytically active thioredoxin (TRX) domain, two TRX-like domains and a C-terminal ER-retention sequence. This protein functions as a pH-regulated chaperone of the secretory pathway and likely plays a role in protein quality control at the endoplasmic reticulum - Golgi interface. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit light coat colour, small stature and scaly tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Erp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Erp44 APN 4 48218126 missense probably benign 0.22
IGL02057:Erp44 APN 4 48236964 missense probably benign 0.05
IGL03165:Erp44 APN 4 48236872 critical splice donor site probably null
IGL03253:Erp44 APN 4 48208750 missense probably benign 0.09
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R4976:Erp44 UTSW 4 48208797 missense probably benign 0.01
R5024:Erp44 UTSW 4 48241296 nonsense probably null
R5224:Erp44 UTSW 4 48279435 missense probably benign
R5359:Erp44 UTSW 4 48211704 missense probably benign
R6128:Erp44 UTSW 4 48243493 missense probably damaging 0.98
R6248:Erp44 UTSW 4 48219479 nonsense probably null
R6649:Erp44 UTSW 4 48205130 missense probably null 0.01
R6653:Erp44 UTSW 4 48205130 missense probably null 0.01
R6911:Erp44 UTSW 4 48204268 missense probably benign 0.17
R7061:Erp44 UTSW 4 48219375 missense probably benign
R7209:Erp44 UTSW 4 48211704 missense probably benign
R7291:Erp44 UTSW 4 48208792 missense probably damaging 1.00
R7369:Erp44 UTSW 4 48218183 missense probably benign
R7703:Erp44 UTSW 4 48196904 missense probably benign 0.09
R7785:Erp44 UTSW 4 48243531 missense probably benign 0.04
R7992:Erp44 UTSW 4 48218136 missense possibly damaging 0.57
R8213:Erp44 UTSW 4 48208783 missense probably benign 0.03
R8332:Erp44 UTSW 4 48243475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGAGACCTGGCATTTTAAGAAG -3'
(R):5'- TGCCTGTAATAGCCATGGTAG -3'

Sequencing Primer
(F):5'- GAAGTAACTTTAAAGGCGCATAACC -3'
(R):5'- CCTGTAATAGCCATGGTAGGATTG -3'
Posted On2016-07-06