Incidental Mutation 'R5252:Cdk12'
ID399131
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98243509 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1078 (N1078Y)
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect unknown
Transcript: ENSMUST00000003203
AA Change: N1078Y
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119
AA Change: N1078Y

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107538
AA Change: N1078Y
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119
AA Change: N1078Y

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107539
AA Change: N1078Y
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119
AA Change: N1078Y

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184250
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
capsized UTSW 11 98241785 missense unknown
Listing UTSW 11 98224467 nonsense probably null
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1129:Cdk12 UTSW 11 98245375 missense unknown
R1337:Cdk12 UTSW 11 98245671 critical splice donor site probably null
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R2570:Cdk12 UTSW 11 98203792 missense possibly damaging 0.94
R4574:Cdk12 UTSW 11 98220988 intron probably benign
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5620:Cdk12 UTSW 11 98210983 missense unknown
R5779:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6371:Cdk12 UTSW 11 98245288 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
R7205:Cdk12 UTSW 11 98224625 missense unknown
R7307:Cdk12 UTSW 11 98249800 nonsense probably null
R7361:Cdk12 UTSW 11 98210468 nonsense probably null
R7365:Cdk12 UTSW 11 98221084 missense unknown
R7447:Cdk12 UTSW 11 98245280 missense unknown
R7514:Cdk12 UTSW 11 98222658 missense unknown
R7831:Cdk12 UTSW 11 98249827 missense unknown
R7877:Cdk12 UTSW 11 98240835 missense unknown
R7914:Cdk12 UTSW 11 98249827 missense unknown
R7960:Cdk12 UTSW 11 98240835 missense unknown
Z1176:Cdk12 UTSW 11 98203941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGGAGTTGGTTCTAGTATCAGTAAG -3'
(R):5'- TTCTAATGTTCCAGTGGATAAAACC -3'

Sequencing Primer
(F):5'- TTGAACTCCTGACCTTCGGAAGAG -3'
(R):5'- CCACAGTGATATGGACATATATGC -3'
Posted On2016-07-06