Incidental Mutation 'R5175:Arhgap35'
ID399141
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16562599 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 847 (R847L)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably damaging
Transcript: ENSMUST00000075845
AA Change: R847L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: R847L

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171937
AA Change: R847L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: R847L

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16562319 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGCTACAAGGGATGCTTG -3'
(R):5'- GGTGATCCCTTTAGTGCAGATG -3'

Sequencing Primer
(F):5'- ACAAGGGATGCTTGTGAATCTCCC -3'
(R):5'- AGTGCAGATGACGTTCTCTC -3'
Posted On2016-07-06