Incidental Mutation 'R5252:Cdk7'
ID399144
Institutional Source Beutler Lab
Gene Symbol Cdk7
Ensembl Gene ENSMUSG00000069089
Gene Namecyclin-dependent kinase 7
SynonymsCdkn7, Crk4, CRK4 PK (CDC2-related-kinase-4 protein kinase)
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100702631-100730939 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 100730460 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 42 (K42*)
Ref Sequence ENSEMBL: ENSMUSP00000153369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091299] [ENSMUST00000225990]
Predicted Effect probably null
Transcript: ENSMUST00000091299
AA Change: K42*
SMART Domains Protein: ENSMUSP00000088845
Gene: ENSMUSG00000069089
AA Change: K42*

DomainStartEndE-ValueType
S_TKc 12 295 7.59e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225056
Predicted Effect probably null
Transcript: ENSMUST00000225990
AA Change: K42*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an essential component of the transcription factor TFIIH, that is involved in transcription initiation and DNA repair. This protein is thought to serve as a direct link between the regulation of transcription and the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null allele exhibit abnormal trophoblast layer morphology, abnormal inner cell mass apoptosis, and complete embryonic lethality during peri-implantation stages. Homoyzgous null MEFs display absent fibroblast proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Cdk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0055:Cdk7 UTSW 13 100719304 nonsense probably null
R0208:Cdk7 UTSW 13 100706514 missense probably benign
R0361:Cdk7 UTSW 13 100711554 nonsense probably null
R2030:Cdk7 UTSW 13 100722674 splice site probably benign
R4994:Cdk7 UTSW 13 100717595 missense probably damaging 1.00
R5121:Cdk7 UTSW 13 100717684 critical splice acceptor site probably null
R5527:Cdk7 UTSW 13 100730472 missense probably damaging 1.00
R7008:Cdk7 UTSW 13 100717621 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCTAAGAGTTGCCTGGCG -3'
(R):5'- TGAAGAAGAGGCCTCCAGAC -3'

Sequencing Primer
(F):5'- CCTGGCGTGGTGGAGTAC -3'
(R):5'- TCCAGACCACGTAGCAGG -3'
Posted On2016-07-06