Incidental Mutation 'R5252:Ppard'
ID399148
Institutional Source Beutler Lab
Gene Symbol Ppard
Ensembl Gene ENSMUSG00000002250
Gene Nameperoxisome proliferator activator receptor delta
SynonymsNr1c2, Pparb/d, PPAR-delta, Peroxisome proliferator-activated receptor beta, Pparb, NUC1, PPARdelta/beta
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28232754-28301469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28298848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 297 (V297I)
Ref Sequence ENSEMBL: ENSMUSP00000002320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002320] [ENSMUST00000169040]
Predicted Effect probably benign
Transcript: ENSMUST00000002320
AA Change: V297I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002320
Gene: ENSMUSG00000002250
AA Change: V297I

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Blast:HOLI 183 208 1e-6 BLAST
HOLI 250 409 1.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166744
Predicted Effect probably benign
Transcript: ENSMUST00000169040
SMART Domains Protein: ENSMUSP00000133077
Gene: ENSMUSG00000002250

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. PPARs are nuclear hormone receptors that bind peroxisome proliferators and control the size and number of peroxisomes produced by cells. PPARs mediate a variety of biological processes, and may be involved in the development of several chronic diseases, including diabetes, obesity, atherosclerosis, and cancer. This protein is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma. It may function as an integrator of transcription repression and nuclear receptor signaling. The expression of this gene is found to be elevated in colorectal cancer cells. The elevated expression can be repressed by adenomatosis polyposis coli (APC), a tumor suppressor protein related to APC/beta-catenin signaling pathway. Knockout studies in mice suggested the role of this protein in myelination of the corpus callosum, lipid metabolism, and epidermal cell proliferation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable prenatal lethality and a range of phenotypes such as placental, brain, skin, hair follicle, adipose and lipid homeostasis abnormalities, growth retardation, reduced fertility, andincreased incidence of tumors/induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Ppard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Ppard APN 17 28298903 missense probably damaging 1.00
IGL02023:Ppard APN 17 28298897 missense probably benign
IGL03027:Ppard APN 17 28299791 missense possibly damaging 0.68
R1687:Ppard UTSW 17 28297180 missense probably damaging 1.00
R1785:Ppard UTSW 17 28298481 critical splice donor site probably null
R1791:Ppard UTSW 17 28286374 missense unknown
R1832:Ppard UTSW 17 28297110 missense probably benign 0.01
R2062:Ppard UTSW 17 28299689 missense probably damaging 1.00
R4732:Ppard UTSW 17 28286443 missense probably benign
R4733:Ppard UTSW 17 28286443 missense probably benign
R4801:Ppard UTSW 17 28286374 missense unknown
R4802:Ppard UTSW 17 28286374 missense unknown
R4803:Ppard UTSW 17 28286374 missense unknown
R5305:Ppard UTSW 17 28298858 missense probably damaging 1.00
R6572:Ppard UTSW 17 28297119 nonsense probably null
R7060:Ppard UTSW 17 28298912 missense probably benign 0.00
R7098:Ppard UTSW 17 28298813 missense possibly damaging 0.94
R7506:Ppard UTSW 17 28298761 missense possibly damaging 0.76
R7599:Ppard UTSW 17 28297117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGCACGTGTTCTACCG -3'
(R):5'- GCTACACTGTCTGAGGTCAG -3'

Sequencing Primer
(F):5'- ACGTGTTCTACCGCTGCCAG -3'
(R):5'- TCCACACAGAATGATGGCCG -3'
Posted On2016-07-06