Incidental Mutation 'R5252:H2-Q4'
ID399150
Institutional Source Beutler Lab
Gene Symbol H2-Q4
Ensembl Gene ENSMUSG00000035929
Gene Namehistocompatibility 2, Q region locus 4
SynonymsH2-Gs10, Qa-4, Qb1, Qb-1, H-2Q4, Qa4, Qat-4
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35379617-35385290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35380435 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 165 (F165L)
Ref Sequence ENSEMBL: ENSMUSP00000080159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081435]
Predicted Effect probably benign
Transcript: ENSMUST00000081435
AA Change: F165L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000080159
Gene: ENSMUSG00000035929
AA Change: F165L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 50 228 1.7e-93 PFAM
IGc1 247 318 8.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173975
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls an antigen on peripheral T-cells of spleen, lymph node and bone marrow, but not on thymocytes. Strain distribution patterns vary by assay, measuring presence/absence of antigen, protein acidic/basic qualities and molecular polymorphisms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in H2-Q4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:H2-Q4 APN 17 35382858 missense probably damaging 1.00
IGL01341:H2-Q4 APN 17 35383002 missense probably damaging 1.00
IGL01538:H2-Q4 APN 17 35383312 missense probably benign 0.03
IGL03258:H2-Q4 APN 17 35380119 missense probably benign 0.29
FR4304:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4340:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4342:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4589:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
LCD18:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
R1655:H2-Q4 UTSW 17 35382905 missense probably damaging 1.00
R1887:H2-Q4 UTSW 17 35380137 missense possibly damaging 0.94
R2013:H2-Q4 UTSW 17 35380550 missense probably damaging 1.00
R2073:H2-Q4 UTSW 17 35380402 missense possibly damaging 0.61
R2403:H2-Q4 UTSW 17 35379997 missense probably damaging 0.99
R3813:H2-Q4 UTSW 17 35383095 missense possibly damaging 0.79
R3928:H2-Q4 UTSW 17 35379690 missense unknown
R5076:H2-Q4 UTSW 17 35380441 missense probably damaging 1.00
R5096:H2-Q4 UTSW 17 35379713 splice site probably benign
R5318:H2-Q4 UTSW 17 35383311 missense possibly damaging 0.48
R5618:H2-Q4 UTSW 17 35379925 missense probably damaging 1.00
R6648:H2-Q4 UTSW 17 35383005 missense probably damaging 1.00
R7351:H2-Q4 UTSW 17 35382878 missense possibly damaging 0.65
R7846:H2-Q4 UTSW 17 35380158 missense probably damaging 0.99
R7929:H2-Q4 UTSW 17 35380158 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAAGTTCGAGGTTCTGAGCAG -3'
(R):5'- TCTTCTTCCCCAGGACTGAG -3'

Sequencing Primer
(F):5'- TTCTGAGCAGAACGGACGC -3'
(R):5'- TTCCCGAGCTCCAGGTATCTG -3'
Posted On2016-07-06