Incidental Mutation 'R5252:Cxxc1'
ID399152
Institutional Source Beutler Lab
Gene Symbol Cxxc1
Ensembl Gene ENSMUSG00000024560
Gene NameCXXC finger 1 (PHD domain)
Synonyms2410002I16Rik, 5830420C16Rik, PHF18, Cgbp, Cfp1
MMRRC Submission 042823-MU
Accession Numbers

Ncbi RefSeq: NM_028868.3; MGI:1921572

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location74216131-74221491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74219951 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 444 (A444V)
Ref Sequence ENSEMBL: ENSMUSP00000025444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025444]
Predicted Effect probably benign
Transcript: ENSMUST00000025444
AA Change: A444V

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025444
Gene: ENSMUSG00000024560
AA Change: A444V

DomainStartEndE-ValueType
PHD 28 74 1.26e-10 SMART
Pfam:zf-CXXC 164 212 2.4e-19 PFAM
low complexity region 237 253 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
low complexity region 325 364 N/A INTRINSIC
Pfam:zf-CpG_bind_C 404 640 2.1e-108 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Strain: 2654854
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a transcriptional activator that binds specifically to non-methylated CpG motifs through its CXXC domain. The protein is a component of the SETD1 complex, regulates gene expression and is essential for vertebrate development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit peri-implantation lethality and failure to gastrulate. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)
 

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Cxxc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Cxxc1 APN 18 74219914 missense possibly damaging 0.83
IGL02250:Cxxc1 APN 18 74219169 missense probably benign 0.00
IGL02640:Cxxc1 APN 18 74221183 missense probably damaging 1.00
IGL02802:Cxxc1 UTSW 18 74219410 nonsense probably null
P0018:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
R0534:Cxxc1 UTSW 18 74218891 missense probably benign 0.00
R0557:Cxxc1 UTSW 18 74218774 missense possibly damaging 0.92
R0576:Cxxc1 UTSW 18 74220185 missense possibly damaging 0.47
R0673:Cxxc1 UTSW 18 74218913 missense possibly damaging 0.92
R1539:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.53
R1714:Cxxc1 UTSW 18 74219863 missense probably damaging 1.00
R4763:Cxxc1 UTSW 18 74219413 missense probably damaging 0.98
R5890:Cxxc1 UTSW 18 74221166 missense possibly damaging 0.68
R6908:Cxxc1 UTSW 18 74220559 missense probably damaging 1.00
R7064:Cxxc1 UTSW 18 74220607 critical splice donor site probably null
R7305:Cxxc1 UTSW 18 74219396 missense probably benign 0.02
R7404:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.95
T0975:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
X0028:Cxxc1 UTSW 18 74218801 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCACTCACTGCTTCTGG -3'
(R):5'- TAGCAACGTTCCATGTGACGC -3'

Sequencing Primer
(F):5'- TGGTGCCTCTCTGCCCG -3'
(R):5'- GATCTGCAGATCTGTGTCATCACTG -3'
Posted On2016-07-06