Incidental Mutation 'R5252:Cabp4'
ID399154
Institutional Source Beutler Lab
Gene Symbol Cabp4
Ensembl Gene ENSMUSG00000024842
Gene Namecalcium binding protein 4
Synonyms
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4135425-4139609 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 4136068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025761] [ENSMUST00000025761] [ENSMUST00000096338]
Predicted Effect probably benign
Transcript: ENSMUST00000025761
SMART Domains Protein: ENSMUSP00000025761
Gene: ENSMUSG00000024842

DomainStartEndE-ValueType
low complexity region 45 67 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
EFh 129 157 1.08e-6 SMART
Blast:EFh 165 193 2e-7 BLAST
EFh 206 234 1.05e-4 SMART
EFh 243 271 1.55e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025761
SMART Domains Protein: ENSMUSP00000025761
Gene: ENSMUSG00000024842

DomainStartEndE-ValueType
low complexity region 45 67 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
EFh 129 157 1.08e-6 SMART
Blast:EFh 165 193 2e-7 BLAST
EFh 206 234 1.05e-4 SMART
EFh 243 271 1.55e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096338
SMART Domains Protein: ENSMUSP00000094062
Gene: ENSMUSG00000044724

DomainStartEndE-ValueType
Pfam:7tm_1 47 295 7e-19 PFAM
low complexity region 347 361 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171743
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CABP family of calcium binding protein characterized by four EF-hand motifs. Mutations in this gene are associated with congenital stationary night blindness type 2B. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice with disruptions in this gene display structural and electrophysiological abnormalities in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Cabp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Cabp4 APN 19 4139407 missense possibly damaging 0.88
IGL01372:Cabp4 APN 19 4139323 missense probably benign 0.15
IGL01650:Cabp4 APN 19 4139324 missense probably benign
IGL02756:Cabp4 APN 19 4138561 missense possibly damaging 0.75
R4809:Cabp4 UTSW 19 4139291 missense probably benign
R4909:Cabp4 UTSW 19 4137121 missense possibly damaging 0.76
R5502:Cabp4 UTSW 19 4131229 unclassified probably benign
R5609:Cabp4 UTSW 19 4139252 missense probably benign 0.37
R7474:Cabp4 UTSW 19 4139399 missense probably benign 0.02
R7732:Cabp4 UTSW 19 4135995 missense probably benign 0.34
X0020:Cabp4 UTSW 19 4139307 missense probably benign
Z1177:Cabp4 UTSW 19 4136222 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGGCAGACTCTGGAGTTG -3'
(R):5'- CTTGGACAGTTTGACAAGGACAGG -3'

Sequencing Primer
(F):5'- TGAACCAGCCTGGGGGAAG -3'
(R):5'- TTTGACAAGGACAGGGATGGAC -3'
Posted On2016-07-06