Incidental Mutation 'R5252:Fas'
ID399158
Institutional Source Beutler Lab
Gene Symbol Fas
Ensembl Gene ENSMUSG00000024778
Gene NameFas (TNF receptor superfamily member 6)
SynonymsAPO-1, CD95, TNFR6, Tnfrsf6
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34290659-34327770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34316643 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 133 (S133P)
Ref Sequence ENSEMBL: ENSMUSP00000025691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025691]
PDB Structure
Structure of the FAS/FADD death domain assembly [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025691
AA Change: S133P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778
AA Change: S133P

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Fas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34318618 missense probably damaging 1.00
IGL01677:Fas APN 19 34318818 missense probably benign 0.09
IGL01834:Fas APN 19 34318603 missense probably benign 0.33
IGL02130:Fas APN 19 34315295 missense probably benign 0.01
IGL02424:Fas APN 19 34327034 missense probably damaging 1.00
IGL02532:Fas APN 19 34316599 missense probably damaging 0.99
IGL02569:Fas APN 19 34320562 missense possibly damaging 0.93
bing UTSW 19 34316569 missense probably damaging 1.00
cherry UTSW 19 34327140 missense probably damaging 0.99
P0021:Fas UTSW 19 34307210 missense probably damaging 0.98
R0525:Fas UTSW 19 34319327 missense probably damaging 1.00
R0588:Fas UTSW 19 34327140 missense probably damaging 0.99
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R2077:Fas UTSW 19 34320553 splice site probably benign
R2283:Fas UTSW 19 34307249 missense probably damaging 1.00
R4154:Fas UTSW 19 34318828 missense possibly damaging 0.72
R5943:Fas UTSW 19 34320587 critical splice donor site probably null
R6474:Fas UTSW 19 34316569 missense probably damaging 1.00
R6837:Fas UTSW 19 34307164 missense probably damaging 0.97
R7640:Fas UTSW 19 34307164 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGCAATGGTAGGTAGTATCTGGC -3'
(R):5'- TGGTGCCAACTGAGCAAAAG -3'

Sequencing Primer
(F):5'- AAGTACACTGCAGCTGTCTTCAG -3'
(R):5'- CCAACTGAGCAAAAGGAGGAC -3'
Posted On2016-07-06