Incidental Mutation 'R5175:Dusp6'
ID 399179
Institutional Source Beutler Lab
Gene Symbol Dusp6
Ensembl Gene ENSMUSG00000019960
Gene Name dual specificity phosphatase 6
Synonyms 1300019I03Rik, MKP-3, PYST1, MKP3
MMRRC Submission 042755-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R5175 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 99099093-99103351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99099864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 104 (D104G)
Ref Sequence ENSEMBL: ENSMUSP00000151438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]
AlphaFold Q9DBB1
Predicted Effect probably benign
Transcript: ENSMUST00000020118
AA Change: D104G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: D104G

DomainStartEndE-ValueType
RHOD 20 145 3.06e-13 SMART
low complexity region 151 187 N/A INTRINSIC
DSPc 206 346 5.51e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220218
Predicted Effect possibly damaging
Transcript: ENSMUST00000220291
AA Change: D104G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,030,114 (GRCm39) M215R probably benign Het
Ago2 A T 15: 72,996,067 (GRCm39) I354K possibly damaging Het
Angel2 T A 1: 190,673,081 (GRCm39) C72* probably null Het
Ank2 T A 3: 126,797,673 (GRCm39) H679L probably damaging Het
Anks1 A T 17: 28,261,562 (GRCm39) Q694L probably damaging Het
Aox3 C T 1: 58,211,487 (GRCm39) P1015S probably benign Het
Arhgap35 C A 7: 16,296,524 (GRCm39) R847L probably damaging Het
Bag4 C A 8: 26,258,379 (GRCm39) C316F probably damaging Het
Camkv T A 9: 107,824,581 (GRCm39) I258N probably damaging Het
Cpt1c G A 7: 44,620,781 (GRCm39) A28V probably damaging Het
Cyp2j13 A T 4: 95,956,452 (GRCm39) M219K possibly damaging Het
Dclk1 G T 3: 55,154,648 (GRCm39) R26L possibly damaging Het
Diras2 A T 13: 52,662,007 (GRCm39) I100N probably damaging Het
Dnah5 T A 15: 28,448,550 (GRCm39) N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 (GRCm38) K55* probably null Het
Eif5b A G 1: 38,084,468 (GRCm39) T819A probably damaging Het
Elfn2 A T 15: 78,558,073 (GRCm39) L158H probably damaging Het
Erp44 T C 4: 48,196,823 (GRCm39) T367A probably benign Het
Fasn A T 11: 120,707,195 (GRCm39) D843E probably benign Het
Fbxw25 T C 9: 109,493,631 (GRCm39) Y20C probably damaging Het
Fer1l6 G A 15: 58,422,126 (GRCm39) G108E probably damaging Het
Fndc7 C T 3: 108,776,482 (GRCm39) V520I probably benign Het
Gm17019 A G 5: 15,082,817 (GRCm39) W46R possibly damaging Het
Gorab G T 1: 163,214,214 (GRCm39) Q239K probably damaging Het
Gsdma2 A G 11: 98,543,438 (GRCm39) T76A probably benign Het
Hnrnpll A C 17: 80,341,499 (GRCm39) C513W possibly damaging Het
Ifrd2 T C 9: 107,467,824 (GRCm39) L170P probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnma1 A G 14: 23,386,106 (GRCm39) probably null Het
Kcnn3 T C 3: 89,516,746 (GRCm39) F385S probably damaging Het
Kif18a T G 2: 109,133,323 (GRCm39) probably null Het
Llgl2 A G 11: 115,741,547 (GRCm39) K559R probably damaging Het
Lrrc8a T C 2: 30,145,524 (GRCm39) C113R probably damaging Het
Mgat5 A G 1: 127,387,649 (GRCm39) N535S probably damaging Het
Myh15 T G 16: 48,889,789 (GRCm39) W127G possibly damaging Het
Npsr1 A G 9: 24,046,111 (GRCm39) R77G probably benign Het
Nub1 T A 5: 24,907,446 (GRCm39) S376R probably benign Het
Or14c44 T C 7: 86,062,254 (GRCm39) V228A probably benign Het
Or4d10c G A 19: 12,065,926 (GRCm39) P77S probably damaging Het
Or4k47 A T 2: 111,451,771 (GRCm39) I216N possibly damaging Het
Or5al6 T C 2: 85,976,301 (GRCm39) Y259C probably damaging Het
Or9i2 G A 19: 13,815,680 (GRCm39) P286S probably damaging Het
Pcdh9 A G 14: 94,125,879 (GRCm39) L97P probably damaging Het
Pkn2 A G 3: 142,504,684 (GRCm39) Y831H probably damaging Het
Plcz1 T G 6: 139,985,389 (GRCm39) I51L possibly damaging Het
Plekhg1 T C 10: 3,915,516 (GRCm39) probably benign Het
Prdm9 A T 17: 15,777,713 (GRCm39) S124T probably benign Het
Prkag1 A C 15: 98,713,596 (GRCm39) V33G possibly damaging Het
Rab25 T A 3: 88,450,728 (GRCm39) Y57F possibly damaging Het
Rb1cc1 A G 1: 6,318,545 (GRCm39) I638V probably benign Het
Rest C A 5: 77,416,219 (GRCm39) D144E probably damaging Het
Rpa2 A G 4: 132,505,151 (GRCm39) D260G probably damaging Het
Sf3b3 A G 8: 111,560,467 (GRCm39) V425A probably benign Het
Sidt2 A T 9: 45,863,086 (GRCm39) M15K probably damaging Het
Slc22a17 A G 14: 55,144,748 (GRCm39) L555P probably damaging Het
Smoc2 A G 17: 14,595,719 (GRCm39) D282G possibly damaging Het
Sorcs3 G A 19: 48,748,284 (GRCm39) probably null Het
Spmap2l C T 5: 77,164,317 (GRCm39) P107S probably benign Het
Srcin1 A G 11: 97,464,703 (GRCm39) W15R probably damaging Het
Stra6l A G 4: 45,870,860 (GRCm39) T259A probably benign Het
Ube3a T C 7: 58,938,465 (GRCm39) F741S probably damaging Het
Vasp C A 7: 18,998,594 (GRCm39) M54I probably benign Het
Vmn1r174 A T 7: 23,454,153 (GRCm39) H273L probably benign Het
Vmn2r50 T A 7: 9,771,644 (GRCm39) I686F probably damaging Het
Vmn2r76 T C 7: 85,877,915 (GRCm39) E494G probably benign Het
Zfp788 A G 7: 41,298,753 (GRCm39) E443G probably damaging Het
Other mutations in Dusp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Dusp6 APN 10 99,101,881 (GRCm39) missense probably damaging 1.00
IGL02687:Dusp6 APN 10 99,102,044 (GRCm39) missense probably damaging 0.97
IGL02996:Dusp6 APN 10 99,100,628 (GRCm39) missense possibly damaging 0.52
IGL03024:Dusp6 APN 10 99,102,156 (GRCm39) missense probably damaging 0.97
R1134:Dusp6 UTSW 10 99,100,816 (GRCm39) missense probably damaging 0.98
R1695:Dusp6 UTSW 10 99,099,555 (GRCm39) start codon destroyed probably null 0.99
R2078:Dusp6 UTSW 10 99,099,686 (GRCm39) missense probably damaging 1.00
R2899:Dusp6 UTSW 10 99,099,707 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R4413:Dusp6 UTSW 10 99,099,786 (GRCm39) missense probably damaging 1.00
R4501:Dusp6 UTSW 10 99,100,457 (GRCm39) missense probably benign 0.41
R5381:Dusp6 UTSW 10 99,102,129 (GRCm39) missense possibly damaging 0.46
R5560:Dusp6 UTSW 10 99,102,103 (GRCm39) missense probably damaging 0.97
R5820:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R7359:Dusp6 UTSW 10 99,099,927 (GRCm39) missense probably benign 0.01
R7398:Dusp6 UTSW 10 99,100,740 (GRCm39) missense probably damaging 1.00
R8075:Dusp6 UTSW 10 99,100,810 (GRCm39) missense possibly damaging 0.63
R8491:Dusp6 UTSW 10 99,102,081 (GRCm39) missense possibly damaging 0.66
R8826:Dusp6 UTSW 10 99,099,469 (GRCm39) start gained probably benign
R9084:Dusp6 UTSW 10 99,099,692 (GRCm39) missense probably benign 0.13
R9125:Dusp6 UTSW 10 99,102,074 (GRCm39) nonsense probably null
R9389:Dusp6 UTSW 10 99,099,839 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTCGTCACACATCGAATCTG -3'
(R):5'- CCCTTGAAGGAGAAGCTACC -3'

Sequencing Primer
(F):5'- CACATCGAATCTGCCATTAATGTGG -3'
(R):5'- GCTCCCCTAAGCGCAATG -3'
Posted On 2016-07-06