Incidental Mutation 'R5175:Actr2'
ID399181
Institutional Source Beutler Lab
Gene Symbol Actr2
Ensembl Gene ENSMUSG00000020152
Gene NameARP2 actin-related protein 2
Synonyms4921510D23Rik, D6Ertd746e, Arp2
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location20062304-20112913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20080114 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 215 (M215R)
Ref Sequence ENSEMBL: ENSMUSP00000000137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000137]
Predicted Effect probably benign
Transcript: ENSMUST00000000137
AA Change: M215R

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000000137
Gene: ENSMUSG00000020152
AA Change: M215R

DomainStartEndE-ValueType
ACTIN 6 390 2.78e-208 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132022
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for this mutation exhibit modifies lethality associated with F5 null Tfpi heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Actr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Actr2 APN 11 20094370 missense probably benign 0.03
IGL00164:Actr2 APN 11 20080015 splice site probably benign
IGL00566:Actr2 APN 11 20072487 missense possibly damaging 0.92
IGL00822:Actr2 APN 11 20094367 missense probably damaging 1.00
IGL02993:Actr2 APN 11 20072514 missense probably damaging 1.00
IGL03330:Actr2 APN 11 20091330 missense probably benign 0.01
R0092:Actr2 UTSW 11 20094308 missense probably benign 0.00
R0129:Actr2 UTSW 11 20100939 splice site probably benign
R0513:Actr2 UTSW 11 20080124 missense probably damaging 1.00
R0848:Actr2 UTSW 11 20072584 missense probably benign 0.02
R0863:Actr2 UTSW 11 20080760 missense probably benign 0.00
R5364:Actr2 UTSW 11 20100797 intron probably benign
R6544:Actr2 UTSW 11 20100933 missense probably damaging 1.00
R7330:Actr2 UTSW 11 20072544 missense probably damaging 1.00
X0021:Actr2 UTSW 11 20080702 missense probably damaging 0.99
X0066:Actr2 UTSW 11 20080065 missense probably benign 0.00
X0066:Actr2 UTSW 11 20080066 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGCACACATAAGACCCTAG -3'
(R):5'- AGCAAGTGCCTTTGACCTTCC -3'

Sequencing Primer
(F):5'- TGTGTGTGTGACCAAACAAACC -3'
(R):5'- CCGAGCCATTTTATCCTCTAGG -3'
Posted On2016-07-06