Incidental Mutation 'R5253:Otof'
ID399186
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission 042824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5253 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30370139 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1985 (S1985P)
Ref Sequence ENSEMBL: ENSMUSP00000073803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000101448] [ENSMUST00000114747]
Predicted Effect probably damaging
Transcript: ENSMUST00000074171
AA Change: S1985P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: S1985P

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101448
SMART Domains Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
Pfam:NYD-SP28 100 200 1.7e-33 PFAM
coiled coil region 280 318 N/A INTRINSIC
low complexity region 455 473 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
low complexity region 599 612 N/A INTRINSIC
Pfam:NYD-SP28_assoc 673 732 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114747
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200001
Meta Mutation Damage Score 0.1499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 40,051,450 noncoding transcript Het
Actrt2 A C 4: 154,667,569 S37A possibly damaging Het
Adcy7 T C 8: 88,314,114 I327T probably damaging Het
Ankrd13b A G 11: 77,473,235 probably benign Het
Arap1 A C 7: 101,388,644 I237L probably benign Het
Arhgap17 A T 7: 123,303,748 Y359N probably benign Het
Atad1 A G 19: 32,674,302 M343T probably benign Het
Cacna1b A T 2: 24,719,952 I392N probably damaging Het
Cacna1c A G 6: 118,597,969 S1914P probably benign Het
Cd300a G T 11: 114,894,751 R174L probably benign Het
Dip2a G A 10: 76,299,997 P356L probably damaging Het
Dsg1c T C 18: 20,272,379 L283P probably damaging Het
Dusp1 T C 17: 26,508,217 N36S probably benign Het
Ercc3 C A 18: 32,269,864 P776Q probably damaging Het
Etv1 A G 12: 38,852,249 R260G possibly damaging Het
Fa2h C G 8: 111,349,237 M251I probably benign Het
Flg2 A G 3: 93,200,812 D49G probably damaging Het
Fras1 A G 5: 96,741,025 E2810G probably damaging Het
Fuk T C 8: 110,883,867 E968G possibly damaging Het
Gabbr1 T C 17: 37,055,913 F343S possibly damaging Het
Gdf2 A G 14: 33,945,307 T329A probably benign Het
Hcn4 T A 9: 58,824,275 I255N unknown Het
Hk3 T G 13: 55,011,011 D485A probably damaging Het
Hook3 T C 8: 26,072,291 T249A probably benign Het
Kcp C T 6: 29,498,520 probably benign Het
Kifc2 G T 15: 76,666,281 R515L possibly damaging Het
Kiss1r A G 10: 79,920,750 Y142C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klrb1a T A 6: 128,619,163 I72L probably benign Het
Lep T A 6: 29,070,863 F62Y probably damaging Het
Lrtm1 A G 14: 29,021,844 T90A probably benign Het
Mug1 A T 6: 121,888,913 D1472V probably benign Het
Ncor2 G T 5: 125,026,930 P1988Q probably benign Het
Nlrp4a C T 7: 26,450,492 S508L probably benign Het
Obp2b T A 2: 25,737,143 D29E probably benign Het
Olfr1123 G A 2: 87,418,668 V207M possibly damaging Het
Olfr1214 A G 2: 88,988,100 L34P possibly damaging Het
Olfr1224-ps1 A T 2: 89,156,457 C239* probably null Het
Olfr725 T C 14: 50,035,288 I38M possibly damaging Het
Olfr803 A G 10: 129,691,732 I103T probably damaging Het
Oxct2a A T 4: 123,323,093 V165E probably damaging Het
Papd5 C A 8: 88,200,023 H20Q possibly damaging Het
Pcdhgb7 T C 18: 37,753,097 V440A possibly damaging Het
Pelp1 C A 11: 70,401,661 G211C probably damaging Het
Phox2a A G 7: 101,822,105 H268R probably benign Het
Pik3c2g T C 6: 139,896,257 probably null Het
Pramel1 T A 4: 143,398,586 M360K probably benign Het
Rbm6 C T 9: 107,852,657 R132K probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc45a1 T C 4: 150,638,270 T386A probably damaging Het
Smad2 A G 18: 76,288,053 Y151C probably damaging Het
Sptbn2 G A 19: 4,750,082 G2188D probably benign Het
Sugt1 G A 14: 79,602,901 probably null Het
Tctn3 T C 19: 40,607,241 S367G probably benign Het
Tead1 G T 7: 112,861,545 D219Y probably damaging Het
Tenm2 G T 11: 36,047,201 Y1548* probably null Het
Tenm3 T A 8: 48,229,198 I2466F possibly damaging Het
Tgm2 G A 2: 158,129,438 P294S probably damaging Het
Tns2 T C 15: 102,111,453 S585P probably damaging Het
Ttc41 A G 10: 86,730,942 K491E probably benign Het
Ttn G A 2: 76,791,551 T15549I probably damaging Het
Vmn1r157 T C 7: 22,761,758 L21P probably damaging Het
Vmn2r81 A G 10: 79,247,986 M65V probably benign Het
Wdr34 T A 2: 30,032,363 probably benign Het
Zcchc14 T C 8: 121,618,694 probably benign Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
R7393:Otof UTSW 5 30370270 missense probably benign 0.45
R7397:Otof UTSW 5 30375707 missense probably damaging 1.00
R7400:Otof UTSW 5 30385188 missense probably benign 0.04
R7428:Otof UTSW 5 30389825 missense probably damaging 1.00
R7456:Otof UTSW 5 30394661 missense probably damaging 1.00
R7505:Otof UTSW 5 30371020 missense probably benign 0.00
R7714:Otof UTSW 5 30370253 missense probably damaging 0.99
R8002:Otof UTSW 5 30380610 missense probably benign 0.10
R8032:Otof UTSW 5 30461798 start codon destroyed probably benign 0.07
Z1176:Otof UTSW 5 30371586 missense probably damaging 0.98
Z1177:Otof UTSW 5 30376297 missense probably damaging 1.00
Z1177:Otof UTSW 5 30383658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATACATGTTTATGTGGATGCAC -3'
(R):5'- CCAGAAACTCCTGCTTGGTG -3'

Sequencing Primer
(F):5'- ACATGTTTATGTGGATGCACATATG -3'
(R):5'- CTGCTTGGTGGAGGTCTCTCAC -3'
Posted On2016-07-06