Mutagenetix > Incidental Mutations

Incidental Mutation 'R5175:Llgl2'

399187

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

042755-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R5175 (G1)

Quality Score

153

Status

Not validated

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115850721 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 559 (K559R)

Ref Sequence

ENSEMBL: ENSMUSP00000099321 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000177736]

Predicted Effect

probably damaging
Transcript: ENSMUST00000103032
AA Change: K559R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: K559R

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000128826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147878

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177736
AA Change: K559R

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: K559R

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr2	A	C	11: 20,080,114	M215R	probably benign	Het
Ago2	A	T	15: 73,124,218	I354K	possibly damaging	Het
Angel2	T	A	1: 190,940,884	C72*	probably null	Het
Ank2	T	A	3: 127,004,024	H679L	probably damaging	Het
Anks1	A	T	17: 28,042,588	Q694L	probably damaging	Het
Aox3	C	T	1: 58,172,328	P1015S	probably benign	Het
Arhgap35	C	A	7: 16,562,599	R847L	probably damaging	Het
Bag4	C	A	8: 25,768,351	C316F	probably damaging	Het
Camkv	T	A	9: 107,947,382	I258N	probably damaging	Het
Cpt1c	G	A	7: 44,971,357	A28V	probably damaging	Het
Cyp2j13	A	T	4: 96,068,215	M219K	possibly damaging	Het
Dclk1	G	T	3: 55,247,227	R26L	possibly damaging	Het
Diras2	A	T	13: 52,507,971	I100N	probably damaging	Het
Dnah5	T	A	15: 28,448,404	N4204K	probably damaging	Het
Dnase1l3	T	A	14: 7,987,386	K55*	probably null	Het
Dusp6	A	G	10: 99,264,002	D104G	possibly damaging	Het
Eif5b	A	G	1: 38,045,387	T819A	probably damaging	Het
Elfn2	A	T	15: 78,673,873	L158H	probably damaging	Het
Erp44	T	C	4: 48,196,823	T367A	probably benign	Het
Fasn	A	T	11: 120,816,369	D843E	probably benign	Het
Fbxw25	T	C	9: 109,664,563	Y20C	probably damaging	Het
Fer1l6	G	A	15: 58,550,277	G108E	probably damaging	Het
Fndc7	C	T	3: 108,869,166	V520I	probably benign	Het
Gm17019	A	G	5: 15,032,803	W46R	possibly damaging	Het
Gorab	G	T	1: 163,386,645	Q239K	probably damaging	Het
Gsdma2	A	G	11: 98,652,612	T76A	probably benign	Het
Hnrnpll	A	C	17: 80,034,070	C513W	possibly damaging	Het
Ifrd2	T	C	9: 107,590,625	L170P	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnma1	A	G	14: 23,336,038		probably null	Het
Kcnn3	T	C	3: 89,609,439	F385S	probably damaging	Het
Kif18a	T	G	2: 109,302,978		probably null	Het
Lrrc8a	T	C	2: 30,255,512	C113R	probably damaging	Het
Mgat5	A	G	1: 127,459,912	N535S	probably damaging	Het
Myh15	T	G	16: 49,069,426	W127G	possibly damaging	Het
Npsr1	A	G	9: 24,134,815	R77G	probably benign	Het
Nub1	T	A	5: 24,702,448	S376R	probably benign	Het
Olfr1040	T	C	2: 86,145,957	Y259C	probably damaging	Het
Olfr1297	A	T	2: 111,621,426	I216N	possibly damaging	Het
Olfr1426	G	A	19: 12,088,562	P77S	probably damaging	Het
Olfr1501	G	A	19: 13,838,316	P286S	probably damaging	Het
Olfr301	T	C	7: 86,413,046	V228A	probably benign	Het
Pcdh9	A	G	14: 93,888,443	L97P	probably damaging	Het
Pkn2	A	G	3: 142,798,923	Y831H	probably damaging	Het
Plcz1	T	G	6: 140,039,663	I51L	possibly damaging	Het
Plekhg1	T	C	10: 3,965,516		probably benign	Het
Prdm9	A	T	17: 15,557,451	S124T	probably benign	Het
Prkag1	A	C	15: 98,815,715	V33G	possibly damaging	Het
Rab25	T	A	3: 88,543,421	Y57F	possibly damaging	Het
Rb1cc1	A	G	1: 6,248,321	I638V	probably benign	Het
Rest	C	A	5: 77,268,372	D144E	probably damaging	Het
Rpa2	A	G	4: 132,777,840	D260G	probably damaging	Het
Sf3b3	A	G	8: 110,833,835	V425A	probably benign	Het
Sidt2	A	T	9: 45,951,788	M15K	probably damaging	Het
Slc22a17	A	G	14: 54,907,291	L555P	probably damaging	Het
Smoc2	A	G	17: 14,375,457	D282G	possibly damaging	Het
Sorcs3	G	A	19: 48,759,845		probably null	Het
Srcin1	A	G	11: 97,573,877	W15R	probably damaging	Het
Stra6l	A	G	4: 45,870,860	T259A	probably benign	Het
Thegl	C	T	5: 77,016,470	P107S	probably benign	Het
Ube3a	T	C	7: 59,288,717	F741S	probably damaging	Het
Vasp	C	A	7: 19,264,669	M54I	probably benign	Het
Vmn1r174	A	T	7: 23,754,728	H273L	probably benign	Het
Vmn2r50	T	A	7: 10,037,717	I686F	probably damaging	Het
Vmn2r76	T	C	7: 86,228,707	E494G	probably benign	Het
Zfp788	A	G	7: 41,649,329	E443G	probably damaging	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0097:Llgl2	UTSW	11	115844497	nonsense	probably null
R0166:Llgl2	UTSW	11	115844854	missense	probably damaging	1.00
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0345:Llgl2	UTSW	11	115849992	splice site	probably benign
R0614:Llgl2	UTSW	11	115850267	missense	probably damaging	1.00
R0980:Llgl2	UTSW	11	115850001	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1832:Llgl2	UTSW	11	115851100	missense	probably damaging	1.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5016:Llgl2	UTSW	11	115853424	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCCGCCTCCAGAAATGAG -3'
(R):5'- TTGCTGGTGATCGAAGAGGC -3'

Sequencing Primer
(F):5'- TCCGCCTCCAGAAATGAGAGTTTG -3'
(R):5'- AGGCCGAAACCATGGCTG -3'

Posted On

2016-07-06