Mutagenetix > Incidental Mutations

Incidental Mutation 'R0454:Cpt1b'

39920

Institutional Source

Beutler Lab

Gene Symbol

Cpt1b

Ensembl Gene

ENSMUSG00000078937

Gene Name

carnitine palmitoyltransferase 1b, muscle

Synonyms

M-CPTI, M-CPT I, Cpt1

MMRRC Submission

038654-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0454 (G1)

Quality Score

211

Status

Not validated

Chromosome

Chromosomal Location

89416405-89425863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89424393 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 111 (I111F)

Ref Sequence

ENSEMBL: ENSMUSP00000104936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023289] [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376] [ENSMUST00000170460] [ENSMUST00000171666]

Predicted Effect

probably benign
Transcript: ENSMUST00000023289

SMART Domains

Protein: ENSMUSP00000023289
Gene: ENSMUSG00000022617

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
Pfam:APH	70	317	1.9e-14	PFAM
Pfam:Choline_kinase	97	308	1.5e-76	PFAM
low complexity region	324	344	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000052315

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109313
AA Change: I111F

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937
AA Change: I111F

Domain	Start	End	E-Value	Type
Pfam:CPT_N	1	47	2.5e-29	PFAM
Pfam:Carn_acyltransf	173	762	1.3e-183	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115278

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165623

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166267

Predicted Effect

probably benign
Transcript: ENSMUST00000168376

SMART Domains

Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937

Domain	Start	End	E-Value	Type
PDB:2LE3\|A	1	42	1e-21	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000168879

SMART Domains

Protein: ENSMUSP00000128188
Gene: ENSMUSG00000078937

Domain	Start	End	E-Value	Type
Pfam:Carn_acyltransf	3	148	3.5e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170334

Predicted Effect

probably benign
Transcript: ENSMUST00000170460

SMART Domains

Protein: ENSMUSP00000128026
Gene: ENSMUSG00000022617

Domain	Start	End	E-Value	Type
Pfam:Choline_kinase	1	176	1e-65	PFAM
Pfam:APH	8	176	6.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171140

Predicted Effect

probably benign
Transcript: ENSMUST00000171666

SMART Domains

Protein: ENSMUSP00000127191
Gene: ENSMUSG00000022617

Domain	Start	End	E-Value	Type
Pfam:Choline_kinase	1	142	2.5e-51	PFAM
Pfam:APH	1	149	6.9e-14	PFAM
Pfam:EcKinase	2	116	8.8e-8	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice die in utero prior to E9.5. Heterozygous mutant mice exhibit susceptibility to fatal hypothermia following cold exposure, with females more severely affected. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	A	G	5: 118,255,821	E88G	possibly damaging	Het
4930447F04Rik	T	C	X: 66,303,668	E91G	unknown	Het
Acot1	A	G	12: 84,017,339	Q407R	probably benign	Het
Adcy10	T	A	1: 165,570,728	Y1465N	probably damaging	Het
Ahsa2	T	A	11: 23,490,702	I249F	probably damaging	Het
Arhgap10	T	C	8: 77,250,965	N721S	probably damaging	Het
Arrdc4	T	G	7: 68,741,871	E216A	probably damaging	Het
Axin1	T	C	17: 26,173,663	V306A	probably benign	Het
BC005561	T	G	5: 104,518,211	S200A	probably benign	Het
Cct3	T	C	3: 88,302,866		probably null	Het
Cfap58	G	A	19: 47,974,680		probably null	Het
Chd9	T	C	8: 90,973,231	S49P	possibly damaging	Het
Clcn2	C	A	16: 20,710,428		probably null	Het
Col26a1	T	C	5: 136,754,193	N286D	probably benign	Het
Cyp4f16	T	A	17: 32,537,087	I30N	probably damaging	Het
Ddc	T	G	11: 11,880,587	D19A	possibly damaging	Het
Depdc1a	T	A	3: 159,516,900		probably null	Het
Evc2	T	A	5: 37,417,484	C1028S	possibly damaging	Het
Fam228a	T	C	12: 4,731,457	E134G	probably damaging	Het
Fasl	T	C	1: 161,787,954	E111G	probably benign	Het
Fbxw10	A	G	11: 62,876,738	N800S	possibly damaging	Het
Fras1	T	C	5: 96,762,665	S3318P	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gad1	T	A	2: 70,579,201	M212K	probably damaging	Het
Gm17455	T	G	10: 60,402,973	S6A	probably benign	Het
Grm5	T	C	7: 88,130,789	S1146P	probably damaging	Het
Gsn	T	C	2: 35,304,639	L649P	probably damaging	Het
H2-DMb1	A	G	17: 34,155,711	T112A	probably benign	Het
Hcn3	T	A	3: 89,152,894	I148F	probably damaging	Het
Hdac10	T	C	15: 89,125,758		probably null	Het
Hk3	C	A	13: 55,008,705	D619Y	probably damaging	Het
Ifi44	T	A	3: 151,745,497	R272S	possibly damaging	Het
Il1rap	A	C	16: 26,698,875	D275A	probably damaging	Het
Itgam	A	T	7: 128,107,980	N660I	probably benign	Het
Itpr3	T	C	17: 27,113,819	M1853T	probably benign	Het
Lrmp	A	G	6: 145,167,984	R293G	possibly damaging	Het
Lrrc8c	A	C	5: 105,607,099	K247Q	probably damaging	Het
Map3k21	T	C	8: 125,942,119	S815P	probably benign	Het
Mast4	A	G	13: 102,751,560	S1114P	probably damaging	Het
Myh8	C	T	11: 67,303,765	Q1601*	probably null	Het
Nhlrc2	A	G	19: 56,570,527	D148G	probably damaging	Het
Nos1	T	A	5: 117,943,320	S1196T	probably benign	Het
Nsmaf	C	T	4: 6,424,874		probably null	Het
Obscn	T	C	11: 58,999,623	D7361G	unknown	Het
Olfr1350	C	T	7: 6,570,360	A123V	probably damaging	Het
Olfr600	C	A	7: 103,346,878	A17S	probably benign	Het
Olfr721-ps1	T	C	14: 14,407,777	V183A	probably damaging	Het
Pank3	T	G	11: 35,777,709	M175R	probably benign	Het
Papolg	A	G	11: 23,879,868		probably null	Het
Pcdhb21	G	A	18: 37,514,513	D232N	probably damaging	Het
Pcdhb22	T	C	18: 37,518,872	F131S	probably damaging	Het
Pik3r6	G	A	11: 68,528,782	A140T	possibly damaging	Het
Pinlyp	T	C	7: 24,542,522	T87A	possibly damaging	Het
Pld1	T	C	3: 28,124,575	S873P	probably damaging	Het
Pld5	T	A	1: 176,274,729	Y49F	probably benign	Het
Polq	T	C	16: 37,034,890	V449A	probably damaging	Het
Prkca	A	G	11: 107,978,280	V69A	probably benign	Het
Ptk6	A	G	2: 181,202,282	S75P	possibly damaging	Het
Ptprq	G	A	10: 107,582,530	Q1662*	probably null	Het
Ptprt	C	A	2: 161,553,822	A1144S	probably damaging	Het
Rrm1	T	A	7: 102,466,926	W684R	probably damaging	Het
Ryr1	T	A	7: 29,036,075	M4093L	probably damaging	Het
Scnn1a	C	T	6: 125,322,226	L90F	probably damaging	Het
Slc25a19	G	T	11: 115,617,597	Y188*	probably null	Het
Slc31a1	C	T	4: 62,385,629		probably benign	Het
Slc5a11	C	G	7: 123,265,235	S351R	possibly damaging	Het
Slc6a17	A	G	3: 107,476,867	L387P	probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Spam1	T	A	6: 24,797,838	L331Q	probably damaging	Het
Spata32	A	G	11: 103,209,299	W127R	probably damaging	Het
Spta1	T	G	1: 174,213,942	I1324S	probably damaging	Het
St6galnac4	A	G	2: 32,594,318	Y176C	probably damaging	Het
Stk10	A	G	11: 32,596,724	E327G	probably damaging	Het
Stxbp5l	T	A	16: 37,134,284	Y912F	possibly damaging	Het
Tchp	G	A	5: 114,720,182	E459K	probably benign	Het
Terf2	C	T	8: 107,096,210	W100*	probably null	Het
Thrsp	T	C	7: 97,417,427	N26S	probably damaging	Het
Tln1	C	A	4: 43,553,504	R297L	probably benign	Het
Tmeff2	C	A	1: 50,928,075	T43N	possibly damaging	Het
Tmx1	C	T	12: 70,453,173	A2V	possibly damaging	Het
Tnks1bp1	T	A	2: 85,072,137	L1053Q	probably damaging	Het
Trmt10b	A	T	4: 45,304,286	K107N	probably damaging	Het
Trpa1	A	T	1: 14,885,748		probably null	Het
Trrap	A	G	5: 144,846,477	K3371R	probably damaging	Het
Tuba3b	G	A	6: 145,618,269	V14I	probably benign	Het
Usp19	T	C	9: 108,494,240		probably null	Het
Usp28	C	A	9: 49,039,101	D615E	possibly damaging	Het
Utp20	T	C	10: 88,822,069	D43G	probably benign	Het
Vmn1r58	T	G	7: 5,410,998	K78Q	possibly damaging	Het
Vmn2r10	T	C	5: 109,003,461	M96V	probably benign	Het
Wdr90	T	C	17: 25,860,049	E273G	probably damaging	Het
Xpc	C	T	6: 91,491,226	A860T	probably benign	Het
Zscan21	T	C	5: 138,133,603	I463T	possibly damaging	Het

Other mutations in Cpt1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Cpt1b	APN	15	89420863	missense	probably benign	0.01
IGL00497:Cpt1b	APN	15	89422293	missense	probably benign	0.22
IGL01142:Cpt1b	APN	15	89418993	missense	probably benign
IGL02329:Cpt1b	APN	15	89423739	missense	probably benign
IGL02740:Cpt1b	APN	15	89424332	missense	probably damaging	1.00
IGL03196:Cpt1b	APN	15	89424395	missense	probably benign
macellaio	UTSW	15	89423654	critical splice donor site	probably null
oleagenous	UTSW	15	89425214	missense	probably damaging	1.00
IGL02796:Cpt1b	UTSW	15	89424802	missense	probably benign	0.04
PIT4519001:Cpt1b	UTSW	15	89418863	missense	probably damaging	1.00
R0276:Cpt1b	UTSW	15	89419959	missense	probably benign	0.12
R0302:Cpt1b	UTSW	15	89417870	missense	probably benign
R1199:Cpt1b	UTSW	15	89419010	missense	probably benign	0.01
R1633:Cpt1b	UTSW	15	89418815	missense	probably damaging	0.98
R1674:Cpt1b	UTSW	15	89422332	missense	possibly damaging	0.64
R2087:Cpt1b	UTSW	15	89422208	missense	probably benign	0.07
R2178:Cpt1b	UTSW	15	89419043	missense	probably damaging	1.00
R2414:Cpt1b	UTSW	15	89420080	splice site	probably benign
R2507:Cpt1b	UTSW	15	89419098	missense	probably benign	0.08
R2883:Cpt1b	UTSW	15	89417869	missense	probably benign	0.00
R3432:Cpt1b	UTSW	15	89423741	missense	possibly damaging	0.85
R3783:Cpt1b	UTSW	15	89425189	missense	probably damaging	1.00
R4574:Cpt1b	UTSW	15	89424044	splice site	probably null
R4737:Cpt1b	UTSW	15	89421406	missense	probably benign	0.03
R5122:Cpt1b	UTSW	15	89424023	missense	probably benign	0.09
R5320:Cpt1b	UTSW	15	89419274	missense	probably benign	0.00
R5365:Cpt1b	UTSW	15	89420107	missense	possibly damaging	0.78
R5699:Cpt1b	UTSW	15	89424273	missense	probably benign	0.44
R5710:Cpt1b	UTSW	15	89425206	missense	probably damaging	1.00
R5873:Cpt1b	UTSW	15	89420728	missense	probably damaging	1.00
R5941:Cpt1b	UTSW	15	89425214	missense	probably damaging	1.00
R6163:Cpt1b	UTSW	15	89424417	missense	probably benign	0.15
R6197:Cpt1b	UTSW	15	89424834	missense	possibly damaging	0.77
R6323:Cpt1b	UTSW	15	89419063	missense	probably benign	0.10
R6486:Cpt1b	UTSW	15	89420824	missense	probably benign
R7571:Cpt1b	UTSW	15	89421343	critical splice donor site	probably null
R7648:Cpt1b	UTSW	15	89421367	missense	probably damaging	1.00
R7743:Cpt1b	UTSW	15	89421404	missense	probably benign	0.25
R7893:Cpt1b	UTSW	15	89423654	critical splice donor site	probably null
R8021:Cpt1b	UTSW	15	89421426	missense	probably benign	0.00
R8207:Cpt1b	UTSW	15	89418815	missense	probably damaging	0.98
R8394:Cpt1b	UTSW	15	89422287	critical splice donor site	probably null
R8552:Cpt1b	UTSW	15	89422321	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATGATTTCAAACCAGATGCCTGC -3'
(R):5'- AGGGCTACCATCTCTCAGTTCCAAG -3'

Sequencing Primer
(F):5'- TGCAACCCTCCCAGTGG -3'
(R):5'- TTTGGTACACTCAGACCAGAG -3'

Posted On

2013-05-23