Incidental Mutation 'R5175:Fer1l6'
ID 399207
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission 042755-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5175 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58422126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 108 (G108E)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: G108E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: G108E

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,030,114 (GRCm39) M215R probably benign Het
Ago2 A T 15: 72,996,067 (GRCm39) I354K possibly damaging Het
Angel2 T A 1: 190,673,081 (GRCm39) C72* probably null Het
Ank2 T A 3: 126,797,673 (GRCm39) H679L probably damaging Het
Anks1 A T 17: 28,261,562 (GRCm39) Q694L probably damaging Het
Aox3 C T 1: 58,211,487 (GRCm39) P1015S probably benign Het
Arhgap35 C A 7: 16,296,524 (GRCm39) R847L probably damaging Het
Bag4 C A 8: 26,258,379 (GRCm39) C316F probably damaging Het
Camkv T A 9: 107,824,581 (GRCm39) I258N probably damaging Het
Cpt1c G A 7: 44,620,781 (GRCm39) A28V probably damaging Het
Cyp2j13 A T 4: 95,956,452 (GRCm39) M219K possibly damaging Het
Dclk1 G T 3: 55,154,648 (GRCm39) R26L possibly damaging Het
Diras2 A T 13: 52,662,007 (GRCm39) I100N probably damaging Het
Dnah5 T A 15: 28,448,550 (GRCm39) N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 (GRCm38) K55* probably null Het
Dusp6 A G 10: 99,099,864 (GRCm39) D104G possibly damaging Het
Eif5b A G 1: 38,084,468 (GRCm39) T819A probably damaging Het
Elfn2 A T 15: 78,558,073 (GRCm39) L158H probably damaging Het
Erp44 T C 4: 48,196,823 (GRCm39) T367A probably benign Het
Fasn A T 11: 120,707,195 (GRCm39) D843E probably benign Het
Fbxw25 T C 9: 109,493,631 (GRCm39) Y20C probably damaging Het
Fndc7 C T 3: 108,776,482 (GRCm39) V520I probably benign Het
Gm17019 A G 5: 15,082,817 (GRCm39) W46R possibly damaging Het
Gorab G T 1: 163,214,214 (GRCm39) Q239K probably damaging Het
Gsdma2 A G 11: 98,543,438 (GRCm39) T76A probably benign Het
Hnrnpll A C 17: 80,341,499 (GRCm39) C513W possibly damaging Het
Ifrd2 T C 9: 107,467,824 (GRCm39) L170P probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnma1 A G 14: 23,386,106 (GRCm39) probably null Het
Kcnn3 T C 3: 89,516,746 (GRCm39) F385S probably damaging Het
Kif18a T G 2: 109,133,323 (GRCm39) probably null Het
Llgl2 A G 11: 115,741,547 (GRCm39) K559R probably damaging Het
Lrrc8a T C 2: 30,145,524 (GRCm39) C113R probably damaging Het
Mgat5 A G 1: 127,387,649 (GRCm39) N535S probably damaging Het
Myh15 T G 16: 48,889,789 (GRCm39) W127G possibly damaging Het
Npsr1 A G 9: 24,046,111 (GRCm39) R77G probably benign Het
Nub1 T A 5: 24,907,446 (GRCm39) S376R probably benign Het
Or14c44 T C 7: 86,062,254 (GRCm39) V228A probably benign Het
Or4d10c G A 19: 12,065,926 (GRCm39) P77S probably damaging Het
Or4k47 A T 2: 111,451,771 (GRCm39) I216N possibly damaging Het
Or5al6 T C 2: 85,976,301 (GRCm39) Y259C probably damaging Het
Or9i2 G A 19: 13,815,680 (GRCm39) P286S probably damaging Het
Pcdh9 A G 14: 94,125,879 (GRCm39) L97P probably damaging Het
Pkn2 A G 3: 142,504,684 (GRCm39) Y831H probably damaging Het
Plcz1 T G 6: 139,985,389 (GRCm39) I51L possibly damaging Het
Plekhg1 T C 10: 3,915,516 (GRCm39) probably benign Het
Prdm9 A T 17: 15,777,713 (GRCm39) S124T probably benign Het
Prkag1 A C 15: 98,713,596 (GRCm39) V33G possibly damaging Het
Rab25 T A 3: 88,450,728 (GRCm39) Y57F possibly damaging Het
Rb1cc1 A G 1: 6,318,545 (GRCm39) I638V probably benign Het
Rest C A 5: 77,416,219 (GRCm39) D144E probably damaging Het
Rpa2 A G 4: 132,505,151 (GRCm39) D260G probably damaging Het
Sf3b3 A G 8: 111,560,467 (GRCm39) V425A probably benign Het
Sidt2 A T 9: 45,863,086 (GRCm39) M15K probably damaging Het
Slc22a17 A G 14: 55,144,748 (GRCm39) L555P probably damaging Het
Smoc2 A G 17: 14,595,719 (GRCm39) D282G possibly damaging Het
Sorcs3 G A 19: 48,748,284 (GRCm39) probably null Het
Spmap2l C T 5: 77,164,317 (GRCm39) P107S probably benign Het
Srcin1 A G 11: 97,464,703 (GRCm39) W15R probably damaging Het
Stra6l A G 4: 45,870,860 (GRCm39) T259A probably benign Het
Ube3a T C 7: 58,938,465 (GRCm39) F741S probably damaging Het
Vasp C A 7: 18,998,594 (GRCm39) M54I probably benign Het
Vmn1r174 A T 7: 23,454,153 (GRCm39) H273L probably benign Het
Vmn2r50 T A 7: 9,771,644 (GRCm39) I686F probably damaging Het
Vmn2r76 T C 7: 85,877,915 (GRCm39) E494G probably benign Het
Zfp788 A G 7: 41,298,753 (GRCm39) E443G probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58,512,060 (GRCm39) missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58,494,331 (GRCm39) missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6784:Fer1l6 UTSW 15 58,443,275 (GRCm39) missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58,435,899 (GRCm39) missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7469:Fer1l6 UTSW 15 58,462,419 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58,499,438 (GRCm39) missense probably benign
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58,494,230 (GRCm39) missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAAACTGCTGACTAAGATCCATG -3'
(R):5'- AATGGGCTGTTGGTCCCTTC -3'

Sequencing Primer
(F):5'- TCCATGATGGAGAGATCAAATCTC -3'
(R):5'- TCCTTCACTGTGGGCCCAG -3'
Posted On 2016-07-06