Incidental Mutation 'R5253:Hook3'
ID399220
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Namehook microtubule tethering protein 3
SynonymsE330005F07Rik, 5830454D03Rik
MMRRC Submission 042824-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5253 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location26021421-26119224 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26072291 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
Predicted Effect probably benign
Transcript: ENSMUST00000037182
AA Change: T249A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: T249A

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211292
Meta Mutation Damage Score 0.0655 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 40,051,450 noncoding transcript Het
Actrt2 A C 4: 154,667,569 S37A possibly damaging Het
Adcy7 T C 8: 88,314,114 I327T probably damaging Het
Ankrd13b A G 11: 77,473,235 probably benign Het
Arap1 A C 7: 101,388,644 I237L probably benign Het
Arhgap17 A T 7: 123,303,748 Y359N probably benign Het
Atad1 A G 19: 32,674,302 M343T probably benign Het
Cacna1b A T 2: 24,719,952 I392N probably damaging Het
Cacna1c A G 6: 118,597,969 S1914P probably benign Het
Cd300a G T 11: 114,894,751 R174L probably benign Het
Dip2a G A 10: 76,299,997 P356L probably damaging Het
Dsg1c T C 18: 20,272,379 L283P probably damaging Het
Dusp1 T C 17: 26,508,217 N36S probably benign Het
Ercc3 C A 18: 32,269,864 P776Q probably damaging Het
Etv1 A G 12: 38,852,249 R260G possibly damaging Het
Fa2h C G 8: 111,349,237 M251I probably benign Het
Flg2 A G 3: 93,200,812 D49G probably damaging Het
Fras1 A G 5: 96,741,025 E2810G probably damaging Het
Fuk T C 8: 110,883,867 E968G possibly damaging Het
Gabbr1 T C 17: 37,055,913 F343S possibly damaging Het
Gdf2 A G 14: 33,945,307 T329A probably benign Het
Hcn4 T A 9: 58,824,275 I255N unknown Het
Hk3 T G 13: 55,011,011 D485A probably damaging Het
Kcp C T 6: 29,498,520 probably benign Het
Kifc2 G T 15: 76,666,281 R515L possibly damaging Het
Kiss1r A G 10: 79,920,750 Y142C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klrb1a T A 6: 128,619,163 I72L probably benign Het
Lep T A 6: 29,070,863 F62Y probably damaging Het
Lrtm1 A G 14: 29,021,844 T90A probably benign Het
Mug1 A T 6: 121,888,913 D1472V probably benign Het
Ncor2 G T 5: 125,026,930 P1988Q probably benign Het
Nlrp4a C T 7: 26,450,492 S508L probably benign Het
Obp2b T A 2: 25,737,143 D29E probably benign Het
Olfr1123 G A 2: 87,418,668 V207M possibly damaging Het
Olfr1214 A G 2: 88,988,100 L34P possibly damaging Het
Olfr1224-ps1 A T 2: 89,156,457 C239* probably null Het
Olfr725 T C 14: 50,035,288 I38M possibly damaging Het
Olfr803 A G 10: 129,691,732 I103T probably damaging Het
Otof A G 5: 30,370,139 S1985P probably damaging Het
Oxct2a A T 4: 123,323,093 V165E probably damaging Het
Papd5 C A 8: 88,200,023 H20Q possibly damaging Het
Pcdhgb7 T C 18: 37,753,097 V440A possibly damaging Het
Pelp1 C A 11: 70,401,661 G211C probably damaging Het
Phox2a A G 7: 101,822,105 H268R probably benign Het
Pik3c2g T C 6: 139,896,257 probably null Het
Pramel1 T A 4: 143,398,586 M360K probably benign Het
Rbm6 C T 9: 107,852,657 R132K probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc45a1 T C 4: 150,638,270 T386A probably damaging Het
Smad2 A G 18: 76,288,053 Y151C probably damaging Het
Sptbn2 G A 19: 4,750,082 G2188D probably benign Het
Sugt1 G A 14: 79,602,901 probably null Het
Tctn3 T C 19: 40,607,241 S367G probably benign Het
Tead1 G T 7: 112,861,545 D219Y probably damaging Het
Tenm2 G T 11: 36,047,201 Y1548* probably null Het
Tenm3 T A 8: 48,229,198 I2466F possibly damaging Het
Tgm2 G A 2: 158,129,438 P294S probably damaging Het
Tns2 T C 15: 102,111,453 S585P probably damaging Het
Ttc41 A G 10: 86,730,942 K491E probably benign Het
Ttn G A 2: 76,791,551 T15549I probably damaging Het
Vmn1r157 T C 7: 22,761,758 L21P probably damaging Het
Vmn2r81 A G 10: 79,247,986 M65V probably benign Het
Wdr34 T A 2: 30,032,363 probably benign Het
Zcchc14 T C 8: 121,618,694 probably benign Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26038106 missense probably damaging 0.98
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R1806:Hook3 UTSW 8 26068659 missense probably damaging 1.00
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26044327 intron probably benign
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6301:Hook3 UTSW 8 26034940 nonsense probably null
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
R7168:Hook3 UTSW 8 26071086 missense probably benign 0.02
R7856:Hook3 UTSW 8 26035221 missense probably damaging 1.00
R7988:Hook3 UTSW 8 26073647 missense probably benign 0.02
R8079:Hook3 UTSW 8 26088058 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGTCTATCTGTGTGCGTCAG -3'
(R):5'- CACAAGAGTTTGAGTTGGATAACC -3'

Sequencing Primer
(F):5'- GCGTCAGAGTTAGCTAATATCTGC -3'
(R):5'- TGAGTTGGATAACCACAGTCC -3'
Posted On2016-07-06