Incidental Mutation 'R5175:Anks1'
ID399221
Institutional Source Beutler Lab
Gene Symbol Anks1
Ensembl Gene ENSMUSG00000024219
Gene Nameankyrin repeat and SAM domain containing 1
SynonymsOdin
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5175 (G1)
Quality Score206
Status Not validated
Chromosome17
Chromosomal Location27909340-28062600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28042588 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 694 (Q694L)
Ref Sequence ENSEMBL: ENSMUSP00000085344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025058] [ENSMUST00000088027] [ENSMUST00000114842]
Predicted Effect probably damaging
Transcript: ENSMUST00000025058
AA Change: Q715L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219
AA Change: Q715L

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
low complexity region 1126 1135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088027
AA Change: Q694L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219
AA Change: Q694L

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 144 173 1.88e-5 SMART
ANK 177 206 1.93e-2 SMART
ANK 210 239 1.64e-5 SMART
ANK 242 271 7.71e-2 SMART
low complexity region 398 418 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
SAM 688 757 3.2e-16 SMART
SAM 762 830 4.33e-13 SMART
Blast:PTB 840 898 2e-22 BLAST
PTB 932 1066 3.17e-43 SMART
low complexity region 1105 1114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114842
AA Change: Q715L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219
AA Change: Q715L

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139173
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Anks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Anks1 APN 17 28058416 missense possibly damaging 0.94
IGL00816:Anks1 APN 17 28059393 critical splice donor site probably null
IGL00940:Anks1 APN 17 28057354 missense probably damaging 1.00
IGL01306:Anks1 APN 17 27986253 missense probably damaging 1.00
IGL01485:Anks1 APN 17 28051584 missense probably damaging 1.00
IGL02059:Anks1 APN 17 28008046 missense possibly damaging 0.64
IGL02220:Anks1 APN 17 28054707 missense probably damaging 0.98
IGL02955:Anks1 APN 17 28054317 missense probably damaging 1.00
IGL03071:Anks1 APN 17 28008199 missense probably benign 0.37
ANU23:Anks1 UTSW 17 27986253 missense probably damaging 1.00
R0389:Anks1 UTSW 17 27995952 missense possibly damaging 0.68
R1221:Anks1 UTSW 17 28050642 missense possibly damaging 0.62
R1523:Anks1 UTSW 17 28051655 splice site probably null
R1639:Anks1 UTSW 17 28058306 missense probably damaging 1.00
R1816:Anks1 UTSW 17 27986573 missense probably damaging 1.00
R1981:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R1982:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R2041:Anks1 UTSW 17 28008414 missense probably damaging 1.00
R2099:Anks1 UTSW 17 27978491 critical splice donor site probably null
R2897:Anks1 UTSW 17 27985363 critical splice donor site probably null
R2965:Anks1 UTSW 17 28053905 missense probably benign
R3624:Anks1 UTSW 17 27986288 missense probably damaging 0.99
R4671:Anks1 UTSW 17 28051578 missense probably benign 0.45
R4786:Anks1 UTSW 17 28052730 missense possibly damaging 0.93
R4871:Anks1 UTSW 17 27991377 missense probably benign 0.00
R4936:Anks1 UTSW 17 27988805 missense probably damaging 1.00
R5908:Anks1 UTSW 17 27996019 missense probably damaging 1.00
R5975:Anks1 UTSW 17 27991447 intron probably null
R6226:Anks1 UTSW 17 28057330 missense probably benign 0.01
R6306:Anks1 UTSW 17 28050639 missense probably damaging 1.00
R6332:Anks1 UTSW 17 28052735 missense probably benign
R6891:Anks1 UTSW 17 28057424 missense probably damaging 1.00
R6995:Anks1 UTSW 17 28054299 missense probably damaging 1.00
R7465:Anks1 UTSW 17 28054323 missense possibly damaging 0.48
R7502:Anks1 UTSW 17 28008140 missense possibly damaging 0.48
R7749:Anks1 UTSW 17 28038141 missense probably damaging 0.96
R8005:Anks1 UTSW 17 28059367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGCCTGTACAGAGAAG -3'
(R):5'- TCAGTTACCCAGCTGACTTCCG -3'

Sequencing Primer
(F):5'- GAAAAGCCGAGAGCCTGCTC -3'
(R):5'- AGCTGACTTCCGGGTGC -3'
Posted On2016-07-06