Incidental Mutation 'R5176:Rusc1'
ID399261
Institutional Source Beutler Lab
Gene Symbol Rusc1
Ensembl Gene ENSMUSG00000041263
Gene NameRUN and SH3 domain containing 1
Synonyms
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89083981-89093311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89089082 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000130477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052539] [ENSMUST00000081848] [ENSMUST00000090929] [ENSMUST00000166687] [ENSMUST00000196043] [ENSMUST00000196223] [ENSMUST00000196254] [ENSMUST00000196709] [ENSMUST00000200659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052539
AA Change: S571P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056640
Gene: ENSMUSG00000041263
AA Change: S571P

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
RUN 589 657 2.75e-16 SMART
low complexity region 669 683 N/A INTRINSIC
low complexity region 702 714 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
SH3 838 893 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081848
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090929
AA Change: S708P

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088447
Gene: ENSMUSG00000041263
AA Change: S708P

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
internal_repeat_1 195 244 5.11e-5 PROSPERO
internal_repeat_1 247 292 5.11e-5 PROSPERO
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 463 479 N/A INTRINSIC
low complexity region 522 543 N/A INTRINSIC
low complexity region 546 584 N/A INTRINSIC
low complexity region 714 725 N/A INTRINSIC
RUN 726 794 2.75e-16 SMART
low complexity region 806 820 N/A INTRINSIC
low complexity region 839 851 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
SH3 975 1030 4.32e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166687
AA Change: S109P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130477
Gene: ENSMUSG00000041263
AA Change: S109P

DomainStartEndE-ValueType
low complexity region 115 126 N/A INTRINSIC
RUN 127 195 2.75e-16 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
SH3 376 431 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196043
SMART Domains Protein: ENSMUSP00000142622
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
PDB:4GIW|B 8 79 5e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196223
AA Change: S109P

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143662
Gene: ENSMUSG00000041263
AA Change: S109P

DomainStartEndE-ValueType
Pfam:RUN 61 166 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196254
SMART Domains Protein: ENSMUSP00000142669
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 1 238 3.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196709
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200357
Predicted Effect possibly damaging
Transcript: ENSMUST00000200659
AA Change: S542P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: S542P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Rusc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Rusc1 APN 3 89092421 missense probably damaging 0.99
IGL02795:Rusc1 APN 3 89091950 missense probably damaging 1.00
IGL03174:Rusc1 APN 3 89091770 missense probably damaging 1.00
R0422:Rusc1 UTSW 3 89086825 missense probably benign 0.01
R1711:Rusc1 UTSW 3 89089293 missense probably damaging 1.00
R1846:Rusc1 UTSW 3 89092145 missense probably damaging 1.00
R2060:Rusc1 UTSW 3 89087848 missense possibly damaging 0.86
R2114:Rusc1 UTSW 3 89091707 missense probably benign
R2209:Rusc1 UTSW 3 89088821 missense probably damaging 1.00
R3081:Rusc1 UTSW 3 89091723 missense possibly damaging 0.84
R3155:Rusc1 UTSW 3 89091731 missense probably benign 0.03
R3156:Rusc1 UTSW 3 89091731 missense probably benign 0.03
R4499:Rusc1 UTSW 3 89092308 missense probably benign 0.02
R4678:Rusc1 UTSW 3 89089720 missense probably damaging 1.00
R4725:Rusc1 UTSW 3 89091429 missense possibly damaging 0.83
R4762:Rusc1 UTSW 3 89091642 missense probably benign
R4890:Rusc1 UTSW 3 89088270 critical splice acceptor site probably null
R5783:Rusc1 UTSW 3 89088145 missense probably damaging 1.00
R5910:Rusc1 UTSW 3 89091720 missense probably benign 0.05
R6189:Rusc1 UTSW 3 89089012 missense probably damaging 1.00
R6190:Rusc1 UTSW 3 89091881 missense probably benign
R6227:Rusc1 UTSW 3 89091741 missense probably benign 0.06
R7087:Rusc1 UTSW 3 89089492 missense probably damaging 0.96
R7184:Rusc1 UTSW 3 89091887 missense possibly damaging 0.61
R7237:Rusc1 UTSW 3 89091498 missense possibly damaging 0.66
R7343:Rusc1 UTSW 3 89091750 missense probably damaging 0.99
R8120:Rusc1 UTSW 3 89089206 missense probably damaging 0.99
R8802:Rusc1 UTSW 3 89092233 missense probably benign
Z1177:Rusc1 UTSW 3 89089033 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGGTCTCTAGAAACAGCTTCC -3'
(R):5'- GCTGTTCCCAGGCTCAATTG -3'

Sequencing Primer
(F):5'- TCTAGAAACAGCTTCCACTACTGTG -3'
(R):5'- CTCAATTGGGGGATAGCCGACTG -3'
Posted On2016-07-06