Incidental Mutation 'R5253:Gdf2'
ID 399262
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Name growth differentiation factor 2
Synonyms Bmp9
MMRRC Submission 042824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5253 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 33662996-33669155 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33667264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 329 (T329A)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720]
AlphaFold Q9WV56
PDB Structure Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000100720
AA Change: T329A

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: T329A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 39,962,746 (GRCm39) noncoding transcript Het
Actrt2 A C 4: 154,752,026 (GRCm39) S37A possibly damaging Het
Adcy7 T C 8: 89,040,742 (GRCm39) I327T probably damaging Het
Ankrd13b A G 11: 77,364,061 (GRCm39) probably benign Het
Arap1 A C 7: 101,037,851 (GRCm39) I237L probably benign Het
Arhgap17 A T 7: 122,902,971 (GRCm39) Y359N probably benign Het
Atad1 A G 19: 32,651,702 (GRCm39) M343T probably benign Het
Cacna1b A T 2: 24,609,964 (GRCm39) I392N probably damaging Het
Cacna1c A G 6: 118,574,930 (GRCm39) S1914P probably benign Het
Cd300a G T 11: 114,785,577 (GRCm39) R174L probably benign Het
Dip2a G A 10: 76,135,831 (GRCm39) P356L probably damaging Het
Dsg1c T C 18: 20,405,436 (GRCm39) L283P probably damaging Het
Dusp1 T C 17: 26,727,191 (GRCm39) N36S probably benign Het
Dync2i2 T A 2: 29,922,375 (GRCm39) probably benign Het
Ercc3 C A 18: 32,402,917 (GRCm39) P776Q probably damaging Het
Etv1 A G 12: 38,902,248 (GRCm39) R260G possibly damaging Het
Fa2h C G 8: 112,075,869 (GRCm39) M251I probably benign Het
Fcsk T C 8: 111,610,499 (GRCm39) E968G possibly damaging Het
Flg2 A G 3: 93,108,119 (GRCm39) D49G probably damaging Het
Fras1 A G 5: 96,888,884 (GRCm39) E2810G probably damaging Het
Gabbr1 T C 17: 37,366,805 (GRCm39) F343S possibly damaging Het
Hcn4 T A 9: 58,731,558 (GRCm39) I255N unknown Het
Hk3 T G 13: 55,158,824 (GRCm39) D485A probably damaging Het
Hook3 T C 8: 26,562,319 (GRCm39) T249A probably benign Het
Kcp C T 6: 29,498,519 (GRCm39) probably benign Het
Kifc2 G T 15: 76,550,481 (GRCm39) R515L possibly damaging Het
Kiss1r A G 10: 79,756,584 (GRCm39) Y142C probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klrb1a T A 6: 128,596,126 (GRCm39) I72L probably benign Het
Lep T A 6: 29,070,862 (GRCm39) F62Y probably damaging Het
Lrtm1 A G 14: 28,743,801 (GRCm39) T90A probably benign Het
Mug1 A T 6: 121,865,872 (GRCm39) D1472V probably benign Het
Ncor2 G T 5: 125,103,994 (GRCm39) P1988Q probably benign Het
Nlrp4a C T 7: 26,149,917 (GRCm39) S508L probably benign Het
Obp2b T A 2: 25,627,155 (GRCm39) D29E probably benign Het
Or10ag2 G A 2: 87,249,012 (GRCm39) V207M possibly damaging Het
Or4c109 A G 2: 88,818,444 (GRCm39) L34P possibly damaging Het
Or4c119 A T 2: 88,986,801 (GRCm39) C239* probably null Het
Or4k15b T C 14: 50,272,745 (GRCm39) I38M possibly damaging Het
Or6c3b A G 10: 129,527,601 (GRCm39) I103T probably damaging Het
Otof A G 5: 30,527,483 (GRCm39) S1985P probably damaging Het
Oxct2a A T 4: 123,216,886 (GRCm39) V165E probably damaging Het
Pcdhgb7 T C 18: 37,886,150 (GRCm39) V440A possibly damaging Het
Pelp1 C A 11: 70,292,487 (GRCm39) G211C probably damaging Het
Phox2a A G 7: 101,471,312 (GRCm39) H268R probably benign Het
Pik3c2g T C 6: 139,841,983 (GRCm39) probably null Het
Pramel1 T A 4: 143,125,156 (GRCm39) M360K probably benign Het
Rbm6 C T 9: 107,729,856 (GRCm39) R132K probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc45a1 T C 4: 150,722,727 (GRCm39) T386A probably damaging Het
Smad2 A G 18: 76,421,124 (GRCm39) Y151C probably damaging Het
Sptbn2 G A 19: 4,800,110 (GRCm39) G2188D probably benign Het
Sugt1 G A 14: 79,840,341 (GRCm39) probably null Het
Tctn3 T C 19: 40,595,685 (GRCm39) S367G probably benign Het
Tead1 G T 7: 112,460,752 (GRCm39) D219Y probably damaging Het
Tenm2 G T 11: 35,938,028 (GRCm39) Y1548* probably null Het
Tenm3 T A 8: 48,682,233 (GRCm39) I2466F possibly damaging Het
Tent4b C A 8: 88,926,651 (GRCm39) H20Q possibly damaging Het
Tgm2 G A 2: 157,971,358 (GRCm39) P294S probably damaging Het
Tns2 T C 15: 102,019,888 (GRCm39) S585P probably damaging Het
Ttc41 A G 10: 86,566,806 (GRCm39) K491E probably benign Het
Ttn G A 2: 76,621,895 (GRCm39) T15549I probably damaging Het
Vmn1r157 T C 7: 22,461,183 (GRCm39) L21P probably damaging Het
Vmn2r81 A G 10: 79,083,820 (GRCm39) M65V probably benign Het
Zcchc14 T C 8: 122,345,433 (GRCm39) probably benign Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33,663,178 (GRCm39) missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33,663,178 (GRCm39) missense probably damaging 1.00
R0739:Gdf2 UTSW 14 33,663,178 (GRCm39) missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33,667,198 (GRCm39) missense probably benign
R2292:Gdf2 UTSW 14 33,667,145 (GRCm39) missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33,666,914 (GRCm39) missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33,666,914 (GRCm39) missense probably damaging 1.00
R3974:Gdf2 UTSW 14 33,666,791 (GRCm39) missense probably damaging 0.97
R3975:Gdf2 UTSW 14 33,666,791 (GRCm39) missense probably damaging 0.97
R3976:Gdf2 UTSW 14 33,666,791 (GRCm39) missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33,667,408 (GRCm39) missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33,666,863 (GRCm39) missense probably benign 0.02
R5227:Gdf2 UTSW 14 33,663,451 (GRCm39) critical splice donor site probably null
R5259:Gdf2 UTSW 14 33,666,788 (GRCm39) missense probably benign 0.01
R6286:Gdf2 UTSW 14 33,667,057 (GRCm39) missense probably damaging 1.00
R7644:Gdf2 UTSW 14 33,666,847 (GRCm39) missense probably benign 0.00
R8472:Gdf2 UTSW 14 33,666,797 (GRCm39) missense probably damaging 1.00
R9067:Gdf2 UTSW 14 33,663,411 (GRCm39) missense probably benign 0.20
R9525:Gdf2 UTSW 14 33,667,564 (GRCm39) makesense probably null
Z1177:Gdf2 UTSW 14 33,667,274 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGACCGCAGCAATGGGAC -3'
(R):5'- ACTCAGTTTGGTGGGAACGC -3'

Sequencing Primer
(F):5'- CCAAGGAGACCAGACTGGAGC -3'
(R):5'- GGAACGCAGCAGGCTTTG -3'
Posted On 2016-07-06