Mutagenetix > Incidental Mutation

Incidental Mutation 'R5253:Gdf2'

399262

Institutional Source

Beutler Lab

Gene Symbol

Gdf2

Ensembl Gene

ENSMUSG00000072625

Gene Name

growth differentiation factor 2

Synonyms

Bmp9

MMRRC Submission

042824-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5253 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33941039-33947198 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33945307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 329 (T329A)

Ref Sequence

ENSEMBL: ENSMUSP00000098286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100720]

AlphaFold

Q9WV56

PDB Structure

Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000100720
AA Change: T329A

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: T329A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	39	50	N/A	INTRINSIC
Pfam:TGFb_propeptide	55	256	8.5e-21	PFAM
TGFB	326	428	3.83e-56	SMART

Meta Mutation Damage Score

0.0635

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J11Rik	T	C	9: 40,051,450		noncoding transcript	Het
Actrt2	A	C	4: 154,667,569	S37A	possibly damaging	Het
Adcy7	T	C	8: 88,314,114	I327T	probably damaging	Het
Ankrd13b	A	G	11: 77,473,235		probably benign	Het
Arap1	A	C	7: 101,388,644	I237L	probably benign	Het
Arhgap17	A	T	7: 123,303,748	Y359N	probably benign	Het
Atad1	A	G	19: 32,674,302	M343T	probably benign	Het
Cacna1b	A	T	2: 24,719,952	I392N	probably damaging	Het
Cacna1c	A	G	6: 118,597,969	S1914P	probably benign	Het
Cd300a	G	T	11: 114,894,751	R174L	probably benign	Het
Dip2a	G	A	10: 76,299,997	P356L	probably damaging	Het
Dsg1c	T	C	18: 20,272,379	L283P	probably damaging	Het
Dusp1	T	C	17: 26,508,217	N36S	probably benign	Het
Ercc3	C	A	18: 32,269,864	P776Q	probably damaging	Het
Etv1	A	G	12: 38,852,249	R260G	possibly damaging	Het
Fa2h	C	G	8: 111,349,237	M251I	probably benign	Het
Flg2	A	G	3: 93,200,812	D49G	probably damaging	Het
Fras1	A	G	5: 96,741,025	E2810G	probably damaging	Het
Fuk	T	C	8: 110,883,867	E968G	possibly damaging	Het
Gabbr1	T	C	17: 37,055,913	F343S	possibly damaging	Het
Hcn4	T	A	9: 58,824,275	I255N	unknown	Het
Hk3	T	G	13: 55,011,011	D485A	probably damaging	Het
Hook3	T	C	8: 26,072,291	T249A	probably benign	Het
Kcp	C	T	6: 29,498,520		probably benign	Het
Kifc2	G	T	15: 76,666,281	R515L	possibly damaging	Het
Kiss1r	A	G	10: 79,920,750	Y142C	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klrb1a	T	A	6: 128,619,163	I72L	probably benign	Het
Lep	T	A	6: 29,070,863	F62Y	probably damaging	Het
Lrtm1	A	G	14: 29,021,844	T90A	probably benign	Het
Mug1	A	T	6: 121,888,913	D1472V	probably benign	Het
Ncor2	G	T	5: 125,026,930	P1988Q	probably benign	Het
Nlrp4a	C	T	7: 26,450,492	S508L	probably benign	Het
Obp2b	T	A	2: 25,737,143	D29E	probably benign	Het
Olfr1123	G	A	2: 87,418,668	V207M	possibly damaging	Het
Olfr1214	A	G	2: 88,988,100	L34P	possibly damaging	Het
Olfr1224-ps1	A	T	2: 89,156,457	C239*	probably null	Het
Olfr725	T	C	14: 50,035,288	I38M	possibly damaging	Het
Olfr803	A	G	10: 129,691,732	I103T	probably damaging	Het
Otof	A	G	5: 30,370,139	S1985P	probably damaging	Het
Oxct2a	A	T	4: 123,323,093	V165E	probably damaging	Het
Papd5	C	A	8: 88,200,023	H20Q	possibly damaging	Het
Pcdhgb7	T	C	18: 37,753,097	V440A	possibly damaging	Het
Pelp1	C	A	11: 70,401,661	G211C	probably damaging	Het
Phox2a	A	G	7: 101,822,105	H268R	probably benign	Het
Pik3c2g	T	C	6: 139,896,257		probably null	Het
Pramel1	T	A	4: 143,398,586	M360K	probably benign	Het
Rbm6	C	T	9: 107,852,657	R132K	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc45a1	T	C	4: 150,638,270	T386A	probably damaging	Het
Smad2	A	G	18: 76,288,053	Y151C	probably damaging	Het
Sptbn2	G	A	19: 4,750,082	G2188D	probably benign	Het
Sugt1	G	A	14: 79,602,901		probably null	Het
Tctn3	T	C	19: 40,607,241	S367G	probably benign	Het
Tead1	G	T	7: 112,861,545	D219Y	probably damaging	Het
Tenm2	G	T	11: 36,047,201	Y1548*	probably null	Het
Tenm3	T	A	8: 48,229,198	I2466F	possibly damaging	Het
Tgm2	G	A	2: 158,129,438	P294S	probably damaging	Het
Tns2	T	C	15: 102,111,453	S585P	probably damaging	Het
Ttc41	A	G	10: 86,730,942	K491E	probably benign	Het
Ttn	G	A	2: 76,791,551	T15549I	probably damaging	Het
Vmn1r157	T	C	7: 22,761,758	L21P	probably damaging	Het
Vmn2r81	A	G	10: 79,247,986	M65V	probably benign	Het
Wdr34	T	A	2: 30,032,363		probably benign	Het
Zcchc14	T	C	8: 121,618,694		probably benign	Het

Other mutations in Gdf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0557:Gdf2	UTSW	14	33941221	missense	probably damaging	1.00
R0631:Gdf2	UTSW	14	33941221	missense	probably damaging	1.00
R0739:Gdf2	UTSW	14	33941221	missense	probably damaging	1.00
R2142:Gdf2	UTSW	14	33945241	missense	probably benign
R2292:Gdf2	UTSW	14	33945188	missense	possibly damaging	0.60
R3615:Gdf2	UTSW	14	33944957	missense	probably damaging	1.00
R3616:Gdf2	UTSW	14	33944957	missense	probably damaging	1.00
R3974:Gdf2	UTSW	14	33944834	missense	probably damaging	0.97
R3975:Gdf2	UTSW	14	33944834	missense	probably damaging	0.97
R3976:Gdf2	UTSW	14	33944834	missense	probably damaging	0.97
R4665:Gdf2	UTSW	14	33945451	missense	probably damaging	1.00
R5007:Gdf2	UTSW	14	33944906	missense	probably benign	0.02
R5227:Gdf2	UTSW	14	33941494	critical splice donor site	probably null
R5259:Gdf2	UTSW	14	33944831	missense	probably benign	0.01
R6286:Gdf2	UTSW	14	33945100	missense	probably damaging	1.00
R7644:Gdf2	UTSW	14	33944890	missense	probably benign	0.00
R8472:Gdf2	UTSW	14	33944840	missense	probably damaging	1.00
R9067:Gdf2	UTSW	14	33941454	missense	probably benign	0.20
R9525:Gdf2	UTSW	14	33945607	makesense	probably null
Z1177:Gdf2	UTSW	14	33945317	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AATGACCGCAGCAATGGGAC -3'
(R):5'- ACTCAGTTTGGTGGGAACGC -3'

Sequencing Primer
(F):5'- CCAAGGAGACCAGACTGGAGC -3'
(R):5'- GGAACGCAGCAGGCTTTG -3'

Posted On

2016-07-06