Incidental Mutation 'R5176:Fkbp15'
ID399267
Institutional Source Beutler Lab
Gene Symbol Fkbp15
Ensembl Gene ENSMUSG00000066151
Gene NameFK506 binding protein 15
SynonymsFKBP133, C430014M02Rik
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62300342-62360548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62312323 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 718 (L718I)
Ref Sequence ENSEMBL: ENSMUSP00000081575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084528]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084527
AA Change: L718I

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151
AA Change: L718I

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084528
AA Change: L718I

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081576
Gene: ENSMUSG00000066151
AA Change: L718I

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2.4e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 2.74e-10 PROSPERO
internal_repeat_1 472 500 2.74e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139308
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Fkbp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Fkbp15 APN 4 62333680 splice site probably benign
IGL01326:Fkbp15 APN 4 62323250 missense probably damaging 0.98
IGL01822:Fkbp15 APN 4 62352504 missense probably benign
IGL01925:Fkbp15 APN 4 62323213 missense probably damaging 1.00
IGL02190:Fkbp15 APN 4 62304822 missense possibly damaging 0.69
IGL02276:Fkbp15 APN 4 62336466 nonsense probably null
IGL02310:Fkbp15 APN 4 62340316 missense probably damaging 1.00
IGL02954:Fkbp15 APN 4 62321065 splice site probably benign
IGL02967:Fkbp15 APN 4 62304390 missense probably damaging 0.96
IGL03136:Fkbp15 APN 4 62340229 splice site probably benign
IGL03185:Fkbp15 APN 4 62332186 splice site probably null
IGL03280:Fkbp15 APN 4 62303267 unclassified probably benign
dura UTSW 4 62324126 missense probably damaging 0.96
mater UTSW 4 62326136 missense probably benign 0.22
R0419:Fkbp15 UTSW 4 62326136 missense probably benign 0.22
R0838:Fkbp15 UTSW 4 62324126 missense probably damaging 0.96
R1241:Fkbp15 UTSW 4 62304609 missense possibly damaging 0.87
R1394:Fkbp15 UTSW 4 62327872 missense probably benign 0.00
R1622:Fkbp15 UTSW 4 62323202 missense possibly damaging 0.94
R1682:Fkbp15 UTSW 4 62324194 missense probably damaging 0.98
R1823:Fkbp15 UTSW 4 62337091 missense probably damaging 1.00
R1994:Fkbp15 UTSW 4 62304381 missense probably benign 0.00
R2132:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2133:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2425:Fkbp15 UTSW 4 62312365 missense probably benign 0.00
R2938:Fkbp15 UTSW 4 62304663 missense probably benign 0.23
R3034:Fkbp15 UTSW 4 62306892 splice site probably null
R3957:Fkbp15 UTSW 4 62334252 missense probably benign 0.01
R3963:Fkbp15 UTSW 4 62340677 missense probably damaging 1.00
R4235:Fkbp15 UTSW 4 62336456 missense probably benign 0.38
R4334:Fkbp15 UTSW 4 62303219 missense possibly damaging 0.95
R4366:Fkbp15 UTSW 4 62336414 missense probably benign 0.38
R4717:Fkbp15 UTSW 4 62308069 missense probably damaging 1.00
R4790:Fkbp15 UTSW 4 62307997 missense probably benign 0.05
R5075:Fkbp15 UTSW 4 62321029 missense probably damaging 0.96
R5419:Fkbp15 UTSW 4 62327877 missense probably damaging 0.98
R5503:Fkbp15 UTSW 4 62327887 missense probably benign 0.05
R5731:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5733:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5820:Fkbp15 UTSW 4 62345546 missense probably benign 0.00
R5878:Fkbp15 UTSW 4 62306908 missense probably benign
R5898:Fkbp15 UTSW 4 62326057 critical splice donor site probably null
R5914:Fkbp15 UTSW 4 62327810 splice site probably null
R6113:Fkbp15 UTSW 4 62340647 missense probably benign 0.38
R6377:Fkbp15 UTSW 4 62324192 missense probably damaging 1.00
R6427:Fkbp15 UTSW 4 62323202 missense probably benign 0.01
R6464:Fkbp15 UTSW 4 62308078 missense possibly damaging 0.92
R6528:Fkbp15 UTSW 4 62332270 missense probably damaging 1.00
R6790:Fkbp15 UTSW 4 62304759 missense probably benign 0.01
R6880:Fkbp15 UTSW 4 62336495 missense possibly damaging 0.71
R6911:Fkbp15 UTSW 4 62340290 missense probably damaging 1.00
R7371:Fkbp15 UTSW 4 62321056 missense possibly damaging 0.89
R7410:Fkbp15 UTSW 4 62340299 missense probably damaging 1.00
R7660:Fkbp15 UTSW 4 62314341 missense probably benign 0.08
X0013:Fkbp15 UTSW 4 62312370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GCAATAACCTACTGCCCTGAGG -3'
(R):5'- GGCGATTAAAGCGTGCAAC -3'

Sequencing Primer
(F):5'- CCCTGAGGGCTAATGTGTTGTC -3'
(R):5'- CGTGCAACTTTGAAAGAGCTCCTG -3'
Posted On2016-07-06