Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Cep135'

399273

Institutional Source

Beutler Lab

Gene Symbol

Cep135

Ensembl Gene

ENSMUSG00000036403

Gene Name

centrosomal protein 135

Synonyms

LOC381644, Cep4

MMRRC Submission

042756-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76588698-76646466 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 76637026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 989 (D989E)

Ref Sequence

ENSEMBL: ENSMUSP00000112602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]

AlphaFold

Q6P5D4

Predicted Effect

probably benign
Transcript: ENSMUST00000049060
AA Change: D989E

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: D989E

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121979
AA Change: D989E

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: D989E

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130651

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Cep135

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Cep135	APN	5	76601459	missense	probably damaging	0.98
IGL01154:Cep135	APN	5	76606796	splice site	probably benign
IGL01323:Cep135	APN	5	76591765	missense	probably benign	0.29
IGL01599:Cep135	APN	5	76593347	missense	possibly damaging	0.93
IGL01923:Cep135	APN	5	76640982	makesense	probably null
IGL02178:Cep135	APN	5	76595474	missense	probably damaging	1.00
IGL02276:Cep135	APN	5	76634246	missense	probably benign	0.00
IGL02344:Cep135	APN	5	76616821	missense	probably benign
IGL02394:Cep135	APN	5	76631471	missense	probably benign	0.02
IGL02740:Cep135	APN	5	76638268	critical splice donor site	probably null
IGL02832:Cep135	APN	5	76640949	missense	probably damaging	0.98
R0026:Cep135	UTSW	5	76606734	nonsense	probably null
R0060:Cep135	UTSW	5	76621350	missense	probably benign	0.20
R0325:Cep135	UTSW	5	76615743	missense	probably damaging	0.98
R0336:Cep135	UTSW	5	76601502	missense	probably benign	0.07
R0564:Cep135	UTSW	5	76615710	missense	probably damaging	1.00
R0564:Cep135	UTSW	5	76638949	missense	probably benign	0.03
R0600:Cep135	UTSW	5	76621305	missense	probably benign
R0636:Cep135	UTSW	5	76615657	missense	probably benign	0.07
R0704:Cep135	UTSW	5	76630949	missense	possibly damaging	0.62
R0835:Cep135	UTSW	5	76615706	missense	probably benign	0.40
R1015:Cep135	UTSW	5	76640997	critical splice donor site	probably null
R1167:Cep135	UTSW	5	76624637	missense	probably damaging	1.00
R1252:Cep135	UTSW	5	76594115	missense	possibly damaging	0.67
R1554:Cep135	UTSW	5	76634213	nonsense	probably null
R1770:Cep135	UTSW	5	76603195	missense	possibly damaging	0.95
R1804:Cep135	UTSW	5	76636932	missense	probably benign	0.22
R1968:Cep135	UTSW	5	76624747	missense	possibly damaging	0.96
R1987:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R1996:Cep135	UTSW	5	76632266	missense	probably benign	0.08
R2004:Cep135	UTSW	5	76632329	critical splice donor site	probably null
R2178:Cep135	UTSW	5	76631450	missense	probably benign	0.00
R2305:Cep135	UTSW	5	76595389	splice site	probably benign
R2679:Cep135	UTSW	5	76624660	missense	probably benign
R3125:Cep135	UTSW	5	76621363	critical splice donor site	probably null
R3623:Cep135	UTSW	5	76624739	missense	probably benign	0.00
R4359:Cep135	UTSW	5	76611714	missense	possibly damaging	0.47
R4407:Cep135	UTSW	5	76624667	missense	probably benign
R4561:Cep135	UTSW	5	76638193	missense	possibly damaging	0.95
R4666:Cep135	UTSW	5	76616854	missense	probably benign
R4945:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R5105:Cep135	UTSW	5	76594092	missense	probably benign	0.00
R5117:Cep135	UTSW	5	76631429	missense	probably benign	0.01
R5194:Cep135	UTSW	5	76615777	missense	probably benign	0.05
R5233:Cep135	UTSW	5	76591843	small deletion	probably benign
R5275:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5295:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5412:Cep135	UTSW	5	76616862	missense	probably benign	0.00
R5427:Cep135	UTSW	5	76638202	missense	probably benign	0.00
R5801:Cep135	UTSW	5	76630676	missense	probably damaging	1.00
R5975:Cep135	UTSW	5	76640890	missense	possibly damaging	0.94
R6087:Cep135	UTSW	5	76615791	critical splice donor site	probably null
R6176:Cep135	UTSW	5	76624643	missense	probably benign
R6210:Cep135	UTSW	5	76624723	missense	probably benign	0.15
R6456:Cep135	UTSW	5	76591724	start gained	probably benign
R6467:Cep135	UTSW	5	76621340	missense	possibly damaging	0.50
R6622:Cep135	UTSW	5	76640968	missense	probably benign	0.00
R6650:Cep135	UTSW	5	76633701	missense	possibly damaging	0.77
R6838:Cep135	UTSW	5	76632215	missense	probably damaging	1.00
R7028:Cep135	UTSW	5	76616848	missense	probably benign
R7049:Cep135	UTSW	5	76606738	missense	probably benign	0.01
R7095:Cep135	UTSW	5	76594058	missense	probably benign	0.10
R7207:Cep135	UTSW	5	76632243	missense	probably benign	0.00
R7330:Cep135	UTSW	5	76606745	nonsense	probably null
R7369:Cep135	UTSW	5	76593253	missense	possibly damaging	0.94
R7741:Cep135	UTSW	5	76630970	missense	probably damaging	0.99
R7850:Cep135	UTSW	5	76591873	critical splice donor site	probably null
R7869:Cep135	UTSW	5	76640956	missense	probably benign	0.00
R7923:Cep135	UTSW	5	76609692	missense	possibly damaging	0.90
R8303:Cep135	UTSW	5	76611728	missense	probably damaging	1.00
R8312:Cep135	UTSW	5	76636899	missense	probably damaging	1.00
R8424:Cep135	UTSW	5	76594059	missense	possibly damaging	0.64
R8490:Cep135	UTSW	5	76638207	missense	probably benign	0.00
R8967:Cep135	UTSW	5	76603318	missense	probably damaging	1.00
R8968:Cep135	UTSW	5	76606729	missense	possibly damaging	0.88
R9126:Cep135	UTSW	5	76633703	missense	probably benign	0.08
R9726:Cep135	UTSW	5	76593304	missense	probably benign
Z1177:Cep135	UTSW	5	76591826	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTTTGAAGGCTTGCACTTTGAG -3'
(R):5'- AGAGTTTGACCTCAGCAGCC -3'

Sequencing Primer
(F):5'- GACTGAGTTACTCATGTTTGGC -3'
(R):5'- CAGGCGGTCAAACCCAGTC -3'

Posted On

2016-07-06