Mutagenetix > Incidental Mutation

Incidental Mutation 'R5253:Smad2'

399281

Institutional Source

Beutler Lab

Gene Symbol

Smad2

Ensembl Gene

ENSMUSG00000024563

Gene Name

SMAD family member 2

Synonyms

Smad 2, Madr2, 7120426M23Rik, Madh2

MMRRC Submission

042824-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5253 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76241580-76305731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76288053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 151 (Y151C)

Ref Sequence

ENSEMBL: ENSMUSP00000125883 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]

AlphaFold

Q62432

Predicted Effect

probably benign
Transcript: ENSMUST00000025453
AA Change: Y151C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: Y151C

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091831
AA Change: Y121C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: Y121C

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	1e-10	BLAST
DWB	242	413	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113930
AA Change: Y121C

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: Y121C

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	9e-11	BLAST
DWB	242	408	4.38e-88	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165084
AA Change: Y121C

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563
AA Change: Y121C

Domain	Start	End	E-Value	Type
DWA	36	144	7.85e-67	SMART
PDB:1KHX\|A	166	204	3e-19	PDB
SCOP:d1khxa_	190	204	7e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168423
AA Change: Y151C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: Y151C

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171256
AA Change: Y151C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: Y151C

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWA	182	213	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172198

SMART Domains

Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
Pfam:MH2	28	58	1.8e-10	PFAM

Meta Mutation Damage Score

0.4536

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J11Rik	T	C	9: 40,051,450		noncoding transcript	Het
Actrt2	A	C	4: 154,667,569	S37A	possibly damaging	Het
Adcy7	T	C	8: 88,314,114	I327T	probably damaging	Het
Ankrd13b	A	G	11: 77,473,235		probably benign	Het
Arap1	A	C	7: 101,388,644	I237L	probably benign	Het
Arhgap17	A	T	7: 123,303,748	Y359N	probably benign	Het
Atad1	A	G	19: 32,674,302	M343T	probably benign	Het
Cacna1b	A	T	2: 24,719,952	I392N	probably damaging	Het
Cacna1c	A	G	6: 118,597,969	S1914P	probably benign	Het
Cd300a	G	T	11: 114,894,751	R174L	probably benign	Het
Dip2a	G	A	10: 76,299,997	P356L	probably damaging	Het
Dsg1c	T	C	18: 20,272,379	L283P	probably damaging	Het
Dusp1	T	C	17: 26,508,217	N36S	probably benign	Het
Ercc3	C	A	18: 32,269,864	P776Q	probably damaging	Het
Etv1	A	G	12: 38,852,249	R260G	possibly damaging	Het
Fa2h	C	G	8: 111,349,237	M251I	probably benign	Het
Flg2	A	G	3: 93,200,812	D49G	probably damaging	Het
Fras1	A	G	5: 96,741,025	E2810G	probably damaging	Het
Fuk	T	C	8: 110,883,867	E968G	possibly damaging	Het
Gabbr1	T	C	17: 37,055,913	F343S	possibly damaging	Het
Gdf2	A	G	14: 33,945,307	T329A	probably benign	Het
Hcn4	T	A	9: 58,824,275	I255N	unknown	Het
Hk3	T	G	13: 55,011,011	D485A	probably damaging	Het
Hook3	T	C	8: 26,072,291	T249A	probably benign	Het
Kcp	C	T	6: 29,498,520		probably benign	Het
Kifc2	G	T	15: 76,666,281	R515L	possibly damaging	Het
Kiss1r	A	G	10: 79,920,750	Y142C	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klrb1a	T	A	6: 128,619,163	I72L	probably benign	Het
Lep	T	A	6: 29,070,863	F62Y	probably damaging	Het
Lrtm1	A	G	14: 29,021,844	T90A	probably benign	Het
Mug1	A	T	6: 121,888,913	D1472V	probably benign	Het
Ncor2	G	T	5: 125,026,930	P1988Q	probably benign	Het
Nlrp4a	C	T	7: 26,450,492	S508L	probably benign	Het
Obp2b	T	A	2: 25,737,143	D29E	probably benign	Het
Olfr1123	G	A	2: 87,418,668	V207M	possibly damaging	Het
Olfr1214	A	G	2: 88,988,100	L34P	possibly damaging	Het
Olfr1224-ps1	A	T	2: 89,156,457	C239*	probably null	Het
Olfr725	T	C	14: 50,035,288	I38M	possibly damaging	Het
Olfr803	A	G	10: 129,691,732	I103T	probably damaging	Het
Otof	A	G	5: 30,370,139	S1985P	probably damaging	Het
Oxct2a	A	T	4: 123,323,093	V165E	probably damaging	Het
Papd5	C	A	8: 88,200,023	H20Q	possibly damaging	Het
Pcdhgb7	T	C	18: 37,753,097	V440A	possibly damaging	Het
Pelp1	C	A	11: 70,401,661	G211C	probably damaging	Het
Phox2a	A	G	7: 101,822,105	H268R	probably benign	Het
Pik3c2g	T	C	6: 139,896,257		probably null	Het
Pramel1	T	A	4: 143,398,586	M360K	probably benign	Het
Rbm6	C	T	9: 107,852,657	R132K	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc45a1	T	C	4: 150,638,270	T386A	probably damaging	Het
Sptbn2	G	A	19: 4,750,082	G2188D	probably benign	Het
Sugt1	G	A	14: 79,602,901		probably null	Het
Tctn3	T	C	19: 40,607,241	S367G	probably benign	Het
Tead1	G	T	7: 112,861,545	D219Y	probably damaging	Het
Tenm2	G	T	11: 36,047,201	Y1548*	probably null	Het
Tenm3	T	A	8: 48,229,198	I2466F	possibly damaging	Het
Tgm2	G	A	2: 158,129,438	P294S	probably damaging	Het
Tns2	T	C	15: 102,111,453	S585P	probably damaging	Het
Ttc41	A	G	10: 86,730,942	K491E	probably benign	Het
Ttn	G	A	2: 76,791,551	T15549I	probably damaging	Het
Vmn1r157	T	C	7: 22,761,758	L21P	probably damaging	Het
Vmn2r81	A	G	10: 79,247,986	M65V	probably benign	Het
Wdr34	T	A	2: 30,032,363		probably benign	Het
Zcchc14	T	C	8: 121,618,694		probably benign	Het

Other mutations in Smad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Smad2	APN	18	76298495	missense	possibly damaging	0.94
IGL00978:Smad2	APN	18	76299775	splice site	probably benign
IGL01295:Smad2	APN	18	76302430	missense	probably benign	0.05
IGL01887:Smad2	APN	18	76299894	missense	probably damaging	1.00
IGL01960:Smad2	APN	18	76262484	intron	probably benign
IGL02881:Smad2	APN	18	76299780	splice site	probably null
IGL02977:Smad2	APN	18	76289164	missense	possibly damaging	0.64
R0333:Smad2	UTSW	18	76262621	missense	probably damaging	1.00
R0391:Smad2	UTSW	18	76289037	critical splice acceptor site	probably null
R0523:Smad2	UTSW	18	76262552	missense	probably benign
R0570:Smad2	UTSW	18	76289179	splice site	probably benign
R0624:Smad2	UTSW	18	76299993	missense	probably damaging	1.00
R1573:Smad2	UTSW	18	76262586	missense	possibly damaging	0.89
R1953:Smad2	UTSW	18	76262705	missense	possibly damaging	0.90
R2132:Smad2	UTSW	18	76288084	nonsense	probably null
R2213:Smad2	UTSW	18	76304626	missense	probably damaging	1.00
R3021:Smad2	UTSW	18	76262632	missense	probably damaging	1.00
R3917:Smad2	UTSW	18	76287937	missense	probably benign	0.42
R4503:Smad2	UTSW	18	76302592	missense	probably benign	0.23
R5290:Smad2	UTSW	18	76262724	missense	probably damaging	1.00
R5891:Smad2	UTSW	18	76299975	missense	probably damaging	1.00
R6294:Smad2	UTSW	18	76289162	missense	probably benign	0.31
R6879:Smad2	UTSW	18	76262654	missense	possibly damaging	0.49
R7430:Smad2	UTSW	18	76288080	missense	probably damaging	1.00
R7503:Smad2	UTSW	18	76286885	missense	probably benign
R7757:Smad2	UTSW	18	76288013	missense	probably benign	0.40
R8072:Smad2	UTSW	18	76286951	critical splice donor site	probably null
R9132:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
R9159:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
R9184:Smad2	UTSW	18	76289100	missense	probably benign	0.00
Z1177:Smad2	UTSW	18	76288002	missense	probably damaging	1.00
Z1177:Smad2	UTSW	18	76288003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTAAAGCTGACTCCACG -3'
(R):5'- TTCAAGCTTCCCTGAGACAC -3'

Sequencing Primer
(F):5'- TAGCCCTGTTGATGACACCTAGG -3'
(R):5'- CAGGAATACTAACCAGCCTTTAGTCG -3'

Posted On

2016-07-06