Incidental Mutation 'R5253:Smad2'
ID 399281
Institutional Source Beutler Lab
Gene Symbol Smad2
Ensembl Gene ENSMUSG00000024563
Gene Name SMAD family member 2
Synonyms Madr2, Madh2, Smad 2, 7120426M23Rik
MMRRC Submission 042824-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5253 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 76374651-76444034 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76421124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 151 (Y151C)
Ref Sequence ENSEMBL: ENSMUSP00000125883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]
AlphaFold Q62432
Predicted Effect probably benign
Transcript: ENSMUST00000025453
AA Change: Y151C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: Y151C

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091831
AA Change: Y121C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: Y121C

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 1e-10 BLAST
DWB 242 413 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113930
AA Change: Y121C

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: Y121C

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 9e-11 BLAST
DWB 242 408 4.38e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165084
AA Change: Y121C

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563
AA Change: Y121C

DomainStartEndE-ValueType
DWA 36 144 7.85e-67 SMART
PDB:1KHX|A 166 204 3e-19 PDB
SCOP:d1khxa_ 190 204 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168423
AA Change: Y151C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: Y151C

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171256
AA Change: Y151C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: Y151C

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWA 182 213 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172198
SMART Domains Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
Pfam:MH2 28 58 1.8e-10 PFAM
Meta Mutation Damage Score 0.4536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 39,962,746 (GRCm39) noncoding transcript Het
Actrt2 A C 4: 154,752,026 (GRCm39) S37A possibly damaging Het
Adcy7 T C 8: 89,040,742 (GRCm39) I327T probably damaging Het
Ankrd13b A G 11: 77,364,061 (GRCm39) probably benign Het
Arap1 A C 7: 101,037,851 (GRCm39) I237L probably benign Het
Arhgap17 A T 7: 122,902,971 (GRCm39) Y359N probably benign Het
Atad1 A G 19: 32,651,702 (GRCm39) M343T probably benign Het
Cacna1b A T 2: 24,609,964 (GRCm39) I392N probably damaging Het
Cacna1c A G 6: 118,574,930 (GRCm39) S1914P probably benign Het
Cd300a G T 11: 114,785,577 (GRCm39) R174L probably benign Het
Dip2a G A 10: 76,135,831 (GRCm39) P356L probably damaging Het
Dsg1c T C 18: 20,405,436 (GRCm39) L283P probably damaging Het
Dusp1 T C 17: 26,727,191 (GRCm39) N36S probably benign Het
Dync2i2 T A 2: 29,922,375 (GRCm39) probably benign Het
Ercc3 C A 18: 32,402,917 (GRCm39) P776Q probably damaging Het
Etv1 A G 12: 38,902,248 (GRCm39) R260G possibly damaging Het
Fa2h C G 8: 112,075,869 (GRCm39) M251I probably benign Het
Fcsk T C 8: 111,610,499 (GRCm39) E968G possibly damaging Het
Flg2 A G 3: 93,108,119 (GRCm39) D49G probably damaging Het
Fras1 A G 5: 96,888,884 (GRCm39) E2810G probably damaging Het
Gabbr1 T C 17: 37,366,805 (GRCm39) F343S possibly damaging Het
Gdf2 A G 14: 33,667,264 (GRCm39) T329A probably benign Het
Hcn4 T A 9: 58,731,558 (GRCm39) I255N unknown Het
Hk3 T G 13: 55,158,824 (GRCm39) D485A probably damaging Het
Hook3 T C 8: 26,562,319 (GRCm39) T249A probably benign Het
Kcp C T 6: 29,498,519 (GRCm39) probably benign Het
Kifc2 G T 15: 76,550,481 (GRCm39) R515L possibly damaging Het
Kiss1r A G 10: 79,756,584 (GRCm39) Y142C probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klrb1a T A 6: 128,596,126 (GRCm39) I72L probably benign Het
Lep T A 6: 29,070,862 (GRCm39) F62Y probably damaging Het
Lrtm1 A G 14: 28,743,801 (GRCm39) T90A probably benign Het
Mug1 A T 6: 121,865,872 (GRCm39) D1472V probably benign Het
Ncor2 G T 5: 125,103,994 (GRCm39) P1988Q probably benign Het
Nlrp4a C T 7: 26,149,917 (GRCm39) S508L probably benign Het
Obp2b T A 2: 25,627,155 (GRCm39) D29E probably benign Het
Or10ag2 G A 2: 87,249,012 (GRCm39) V207M possibly damaging Het
Or4c109 A G 2: 88,818,444 (GRCm39) L34P possibly damaging Het
Or4c119 A T 2: 88,986,801 (GRCm39) C239* probably null Het
Or4k15b T C 14: 50,272,745 (GRCm39) I38M possibly damaging Het
Or6c3b A G 10: 129,527,601 (GRCm39) I103T probably damaging Het
Otof A G 5: 30,527,483 (GRCm39) S1985P probably damaging Het
Oxct2a A T 4: 123,216,886 (GRCm39) V165E probably damaging Het
Pcdhgb7 T C 18: 37,886,150 (GRCm39) V440A possibly damaging Het
Pelp1 C A 11: 70,292,487 (GRCm39) G211C probably damaging Het
Phox2a A G 7: 101,471,312 (GRCm39) H268R probably benign Het
Pik3c2g T C 6: 139,841,983 (GRCm39) probably null Het
Pramel1 T A 4: 143,125,156 (GRCm39) M360K probably benign Het
Rbm6 C T 9: 107,729,856 (GRCm39) R132K probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc45a1 T C 4: 150,722,727 (GRCm39) T386A probably damaging Het
Sptbn2 G A 19: 4,800,110 (GRCm39) G2188D probably benign Het
Sugt1 G A 14: 79,840,341 (GRCm39) probably null Het
Tctn3 T C 19: 40,595,685 (GRCm39) S367G probably benign Het
Tead1 G T 7: 112,460,752 (GRCm39) D219Y probably damaging Het
Tenm2 G T 11: 35,938,028 (GRCm39) Y1548* probably null Het
Tenm3 T A 8: 48,682,233 (GRCm39) I2466F possibly damaging Het
Tent4b C A 8: 88,926,651 (GRCm39) H20Q possibly damaging Het
Tgm2 G A 2: 157,971,358 (GRCm39) P294S probably damaging Het
Tns2 T C 15: 102,019,888 (GRCm39) S585P probably damaging Het
Ttc41 A G 10: 86,566,806 (GRCm39) K491E probably benign Het
Ttn G A 2: 76,621,895 (GRCm39) T15549I probably damaging Het
Vmn1r157 T C 7: 22,461,183 (GRCm39) L21P probably damaging Het
Vmn2r81 A G 10: 79,083,820 (GRCm39) M65V probably benign Het
Zcchc14 T C 8: 122,345,433 (GRCm39) probably benign Het
Other mutations in Smad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Smad2 APN 18 76,431,566 (GRCm39) missense possibly damaging 0.94
IGL00978:Smad2 APN 18 76,432,846 (GRCm39) splice site probably benign
IGL01295:Smad2 APN 18 76,435,501 (GRCm39) missense probably benign 0.05
IGL01887:Smad2 APN 18 76,432,965 (GRCm39) missense probably damaging 1.00
IGL01960:Smad2 APN 18 76,395,555 (GRCm39) intron probably benign
IGL02881:Smad2 APN 18 76,432,851 (GRCm39) splice site probably null
IGL02977:Smad2 APN 18 76,422,235 (GRCm39) missense possibly damaging 0.64
R0333:Smad2 UTSW 18 76,395,692 (GRCm39) missense probably damaging 1.00
R0391:Smad2 UTSW 18 76,422,108 (GRCm39) critical splice acceptor site probably null
R0523:Smad2 UTSW 18 76,395,623 (GRCm39) missense probably benign
R0570:Smad2 UTSW 18 76,422,250 (GRCm39) splice site probably benign
R0624:Smad2 UTSW 18 76,433,064 (GRCm39) missense probably damaging 1.00
R1573:Smad2 UTSW 18 76,395,657 (GRCm39) missense possibly damaging 0.89
R1953:Smad2 UTSW 18 76,395,776 (GRCm39) missense possibly damaging 0.90
R2132:Smad2 UTSW 18 76,421,155 (GRCm39) nonsense probably null
R2213:Smad2 UTSW 18 76,437,697 (GRCm39) missense probably damaging 1.00
R3021:Smad2 UTSW 18 76,395,703 (GRCm39) missense probably damaging 1.00
R3917:Smad2 UTSW 18 76,421,008 (GRCm39) missense probably benign 0.42
R4503:Smad2 UTSW 18 76,435,663 (GRCm39) missense probably benign 0.23
R5290:Smad2 UTSW 18 76,395,795 (GRCm39) missense probably damaging 1.00
R5891:Smad2 UTSW 18 76,433,046 (GRCm39) missense probably damaging 1.00
R6294:Smad2 UTSW 18 76,422,233 (GRCm39) missense probably benign 0.31
R6879:Smad2 UTSW 18 76,395,725 (GRCm39) missense possibly damaging 0.49
R7430:Smad2 UTSW 18 76,421,151 (GRCm39) missense probably damaging 1.00
R7503:Smad2 UTSW 18 76,419,956 (GRCm39) missense probably benign
R7757:Smad2 UTSW 18 76,421,084 (GRCm39) missense probably benign 0.40
R8072:Smad2 UTSW 18 76,420,022 (GRCm39) critical splice donor site probably null
R9132:Smad2 UTSW 18 76,395,573 (GRCm39) missense possibly damaging 0.87
R9159:Smad2 UTSW 18 76,395,573 (GRCm39) missense possibly damaging 0.87
R9184:Smad2 UTSW 18 76,422,171 (GRCm39) missense probably benign 0.00
Z1177:Smad2 UTSW 18 76,421,074 (GRCm39) missense probably damaging 1.00
Z1177:Smad2 UTSW 18 76,421,073 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAAAGCTGACTCCACG -3'
(R):5'- TTCAAGCTTCCCTGAGACAC -3'

Sequencing Primer
(F):5'- TAGCCCTGTTGATGACACCTAGG -3'
(R):5'- CAGGAATACTAACCAGCCTTTAGTCG -3'
Posted On 2016-07-06