Mutagenetix > Incidental Mutation

Incidental Mutation 'R5253:Sptbn2'

399283

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

042824-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5253 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4711208-4752353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 4750082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 2188 (G2188D)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]

AlphaFold

Q68FG2

Predicted Effect

probably benign
Transcript: ENSMUST00000008991
AA Change: G2188D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: G2188D

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178353

SMART Domains

Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

Domain	Start	End	E-Value	Type
RRM	2	69	1.96e-17	SMART
Pfam:RRM_1	81	118	5.6e-7	PFAM

Meta Mutation Damage Score

0.1155

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J11Rik	T	C	9: 40,051,450		noncoding transcript	Het
Actrt2	A	C	4: 154,667,569	S37A	possibly damaging	Het
Adcy7	T	C	8: 88,314,114	I327T	probably damaging	Het
Ankrd13b	A	G	11: 77,473,235		probably benign	Het
Arap1	A	C	7: 101,388,644	I237L	probably benign	Het
Arhgap17	A	T	7: 123,303,748	Y359N	probably benign	Het
Atad1	A	G	19: 32,674,302	M343T	probably benign	Het
Cacna1b	A	T	2: 24,719,952	I392N	probably damaging	Het
Cacna1c	A	G	6: 118,597,969	S1914P	probably benign	Het
Cd300a	G	T	11: 114,894,751	R174L	probably benign	Het
Dip2a	G	A	10: 76,299,997	P356L	probably damaging	Het
Dsg1c	T	C	18: 20,272,379	L283P	probably damaging	Het
Dusp1	T	C	17: 26,508,217	N36S	probably benign	Het
Ercc3	C	A	18: 32,269,864	P776Q	probably damaging	Het
Etv1	A	G	12: 38,852,249	R260G	possibly damaging	Het
Fa2h	C	G	8: 111,349,237	M251I	probably benign	Het
Flg2	A	G	3: 93,200,812	D49G	probably damaging	Het
Fras1	A	G	5: 96,741,025	E2810G	probably damaging	Het
Fuk	T	C	8: 110,883,867	E968G	possibly damaging	Het
Gabbr1	T	C	17: 37,055,913	F343S	possibly damaging	Het
Gdf2	A	G	14: 33,945,307	T329A	probably benign	Het
Hcn4	T	A	9: 58,824,275	I255N	unknown	Het
Hk3	T	G	13: 55,011,011	D485A	probably damaging	Het
Hook3	T	C	8: 26,072,291	T249A	probably benign	Het
Kcp	C	T	6: 29,498,520		probably benign	Het
Kifc2	G	T	15: 76,666,281	R515L	possibly damaging	Het
Kiss1r	A	G	10: 79,920,750	Y142C	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klrb1a	T	A	6: 128,619,163	I72L	probably benign	Het
Lep	T	A	6: 29,070,863	F62Y	probably damaging	Het
Lrtm1	A	G	14: 29,021,844	T90A	probably benign	Het
Mug1	A	T	6: 121,888,913	D1472V	probably benign	Het
Ncor2	G	T	5: 125,026,930	P1988Q	probably benign	Het
Nlrp4a	C	T	7: 26,450,492	S508L	probably benign	Het
Obp2b	T	A	2: 25,737,143	D29E	probably benign	Het
Olfr1123	G	A	2: 87,418,668	V207M	possibly damaging	Het
Olfr1214	A	G	2: 88,988,100	L34P	possibly damaging	Het
Olfr1224-ps1	A	T	2: 89,156,457	C239*	probably null	Het
Olfr725	T	C	14: 50,035,288	I38M	possibly damaging	Het
Olfr803	A	G	10: 129,691,732	I103T	probably damaging	Het
Otof	A	G	5: 30,370,139	S1985P	probably damaging	Het
Oxct2a	A	T	4: 123,323,093	V165E	probably damaging	Het
Papd5	C	A	8: 88,200,023	H20Q	possibly damaging	Het
Pcdhgb7	T	C	18: 37,753,097	V440A	possibly damaging	Het
Pelp1	C	A	11: 70,401,661	G211C	probably damaging	Het
Phox2a	A	G	7: 101,822,105	H268R	probably benign	Het
Pik3c2g	T	C	6: 139,896,257		probably null	Het
Pramel1	T	A	4: 143,398,586	M360K	probably benign	Het
Rbm6	C	T	9: 107,852,657	R132K	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc45a1	T	C	4: 150,638,270	T386A	probably damaging	Het
Smad2	A	G	18: 76,288,053	Y151C	probably damaging	Het
Sugt1	G	A	14: 79,602,901		probably null	Het
Tctn3	T	C	19: 40,607,241	S367G	probably benign	Het
Tead1	G	T	7: 112,861,545	D219Y	probably damaging	Het
Tenm2	G	T	11: 36,047,201	Y1548*	probably null	Het
Tenm3	T	A	8: 48,229,198	I2466F	possibly damaging	Het
Tgm2	G	A	2: 158,129,438	P294S	probably damaging	Het
Tns2	T	C	15: 102,111,453	S585P	probably damaging	Het
Ttc41	A	G	10: 86,730,942	K491E	probably benign	Het
Ttn	G	A	2: 76,791,551	T15549I	probably damaging	Het
Vmn1r157	T	C	7: 22,761,758	L21P	probably damaging	Het
Vmn2r81	A	G	10: 79,247,986	M65V	probably benign	Het
Wdr34	T	A	2: 30,032,363		probably benign	Het
Zcchc14	T	C	8: 121,618,694		probably benign	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4724705	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4725938	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01373:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01420:Sptbn2	APN	19	4734125	missense	probably benign
IGL01456:Sptbn2	APN	19	4746749	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4749693	missense	probably benign
IGL03026:Sptbn2	APN	19	4724233	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4732661	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4747832	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4745577	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0121:Sptbn2	UTSW	19	4745293	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4724744	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4746942	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4745145	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4737926	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4745938	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4726690	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4739986	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4748123	nonsense	probably null
R0742:Sptbn2	UTSW	19	4718983	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4732665	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4718976	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4744246	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4750242	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4750497	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4745964	nonsense	probably null
R1820:Sptbn2	UTSW	19	4726596	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4732541	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4732685	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4745299	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4738559	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4734138	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4718935	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4748636	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4745922	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4738355	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4732602	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4739239	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4732496	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4742480	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4748154	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4729430	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4738469	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4729309	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4729202	splice site	probably null
R4981:Sptbn2	UTSW	19	4751658	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4737857	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4724184	missense	probably damaging	1.00
R5294:Sptbn2	UTSW	19	4718908	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4750105	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4725950	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4748947	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4724667	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4738219	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4739278	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4731392	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4748138	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4724646	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4732496	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4742418	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4744180	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4747926	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4749814	missense	probably benign
R6703:Sptbn2	UTSW	19	4749815	missense	probably benign
R6753:Sptbn2	UTSW	19	4747785	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4744145	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4749460	missense	probably null
R7219:Sptbn2	UTSW	19	4724173	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4737443	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4751574	missense	probably benign
R7469:Sptbn2	UTSW	19	4745118	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4748082	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4726168	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4744207	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4724125	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4734143	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4744262	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4746799	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4737403	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4729130	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4746696	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4734213	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4739946	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4738190	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4745313	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4738205	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4745191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCCTGGGTATGAGGTTCAACAG -3'
(R):5'- TCTTCAGAAGCAGAAACCCG -3'

Sequencing Primer
(F):5'- GTTCAACAGAAGCTTGGGC -3'
(R):5'- ACAGCACAGCCAGGGTTGATAC -3'

Posted On

2016-07-06