Incidental Mutation 'R5176:Apobr'
ID399287
Institutional Source Beutler Lab
Gene Symbol Apobr
Ensembl Gene ENSMUSG00000042759
Gene Nameapolipoprotein B receptor
SynonymsApob-48r, Apob48r
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126584942-126589112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126585016 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000042028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032962] [ENSMUST00000039522] [ENSMUST00000058429] [ENSMUST00000084589] [ENSMUST00000098036] [ENSMUST00000116269] [ENSMUST00000125508] [ENSMUST00000128970] [ENSMUST00000131860] [ENSMUST00000137646] [ENSMUST00000138558] [ENSMUST00000144173] [ENSMUST00000147086] [ENSMUST00000150311] [ENSMUST00000150587] [ENSMUST00000150917]
Predicted Effect probably benign
Transcript: ENSMUST00000032962
SMART Domains Protein: ENSMUSP00000032962
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000039522
AA Change: D2G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042028
Gene: ENSMUSG00000042759
AA Change: D2G

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 171 181 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
low complexity region 588 608 N/A INTRINSIC
low complexity region 837 862 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058429
SMART Domains Protein: ENSMUSP00000054637
Gene: ENSMUSG00000044701

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 210 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084589
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098036
SMART Domains Protein: ENSMUSP00000095644
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 414 4.3e-191 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116269
SMART Domains Protein: ENSMUSP00000111973
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 39 437 1.6e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125508
SMART Domains Protein: ENSMUSP00000117561
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 76 1.2e-17 PFAM
Pfam:CLN3 73 151 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128225
Predicted Effect probably benign
Transcript: ENSMUST00000128970
SMART Domains Protein: ENSMUSP00000114901
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 196 1.2e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131860
AA Change: D2G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134498
Predicted Effect unknown
Transcript: ENSMUST00000137646
AA Change: D2G
Predicted Effect probably benign
Transcript: ENSMUST00000138558
Predicted Effect probably benign
Transcript: ENSMUST00000144173
Predicted Effect probably benign
Transcript: ENSMUST00000147086
Predicted Effect probably benign
Transcript: ENSMUST00000150311
SMART Domains Protein: ENSMUSP00000116160
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 69 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150587
SMART Domains Protein: ENSMUSP00000118054
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 70 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150917
SMART Domains Protein: ENSMUSP00000138688
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 77 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153790
Meta Mutation Damage Score 0.2354 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apolipoprotein B48 receptor is a macrophage receptor that binds to the apolipoprotein B48 of dietary triglyceride (TG)-rich lipoproteins. This receptor may provide essential lipids, lipid-soluble vitamins and other nutrients to reticuloendothelial cells. If overwhelmed with elevated plasma triglyceride, the apolipoprotein B48 receptor may contribute to foam cell formation, endothelial dysfunction, and atherothrombogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Apobr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Apobr APN 7 126587922 missense probably damaging 1.00
IGL02373:Apobr APN 7 126585391 missense probably damaging 1.00
IGL02383:Apobr APN 7 126586607 missense probably benign 0.35
R0626:Apobr UTSW 7 126586655 missense possibly damaging 0.73
R1142:Apobr UTSW 7 126587482 missense probably benign 0.01
R1672:Apobr UTSW 7 126587551 missense probably benign 0.31
R1711:Apobr UTSW 7 126584979 start gained probably null
R1865:Apobr UTSW 7 126585968 missense probably benign 0.00
R1971:Apobr UTSW 7 126586225 missense probably benign 0.00
R1985:Apobr UTSW 7 126587731 missense possibly damaging 0.66
R2130:Apobr UTSW 7 126587206 missense probably benign 0.15
R2143:Apobr UTSW 7 126587116 missense probably benign 0.01
R4497:Apobr UTSW 7 126587522 intron probably null
R4693:Apobr UTSW 7 126586847 missense probably damaging 0.96
R4797:Apobr UTSW 7 126587584 missense probably benign 0.30
R4814:Apobr UTSW 7 126586687 missense probably benign 0.03
R5000:Apobr UTSW 7 126586557 missense possibly damaging 0.53
R5153:Apobr UTSW 7 126587732 missense possibly damaging 0.92
R5285:Apobr UTSW 7 126585003 unclassified probably benign
R5296:Apobr UTSW 7 126588024 missense probably damaging 0.96
R5579:Apobr UTSW 7 126587675 missense probably benign 0.00
Z1088:Apobr UTSW 7 126585031 missense probably benign 0.00
Z1176:Apobr UTSW 7 126587264 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACACTGTTAAGCCATCCCC -3'
(R):5'- GGTACACTTGTAGAGGCAGG -3'

Sequencing Primer
(F):5'- CCCCTGCCTGTCATGAAG -3'
(R):5'- TACACTTGTAGAGGCAGGAGATTG -3'
Posted On2016-07-06