Incidental Mutation 'R5253:Tctn3'
ID399288
Institutional Source Beutler Lab
Gene Symbol Tctn3
Ensembl Gene ENSMUSG00000025008
Gene Nametectonic family member 3
Synonyms4930521E07Rik, Tect3
MMRRC Submission 042824-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5253 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40596446-40612233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40607241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 367 (S367G)
Ref Sequence ENSEMBL: ENSMUSP00000121760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025981] [ENSMUST00000132452] [ENSMUST00000135795]
Predicted Effect probably benign
Transcript: ENSMUST00000025981
SMART Domains Protein: ENSMUSP00000025981
Gene: ENSMUSG00000025008

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 6.3e-83 PFAM
low complexity region 578 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132452
AA Change: S367G

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121760
Gene: ENSMUSG00000025008
AA Change: S367G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 364 3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135795
SMART Domains Protein: ENSMUSP00000123461
Gene: ENSMUSG00000025008

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 2.5e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144566
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 40,051,450 noncoding transcript Het
Actrt2 A C 4: 154,667,569 S37A possibly damaging Het
Adcy7 T C 8: 88,314,114 I327T probably damaging Het
Ankrd13b A G 11: 77,473,235 probably benign Het
Arap1 A C 7: 101,388,644 I237L probably benign Het
Arhgap17 A T 7: 123,303,748 Y359N probably benign Het
Atad1 A G 19: 32,674,302 M343T probably benign Het
Cacna1b A T 2: 24,719,952 I392N probably damaging Het
Cacna1c A G 6: 118,597,969 S1914P probably benign Het
Cd300a G T 11: 114,894,751 R174L probably benign Het
Dip2a G A 10: 76,299,997 P356L probably damaging Het
Dsg1c T C 18: 20,272,379 L283P probably damaging Het
Dusp1 T C 17: 26,508,217 N36S probably benign Het
Ercc3 C A 18: 32,269,864 P776Q probably damaging Het
Etv1 A G 12: 38,852,249 R260G possibly damaging Het
Fa2h C G 8: 111,349,237 M251I probably benign Het
Flg2 A G 3: 93,200,812 D49G probably damaging Het
Fras1 A G 5: 96,741,025 E2810G probably damaging Het
Fuk T C 8: 110,883,867 E968G possibly damaging Het
Gabbr1 T C 17: 37,055,913 F343S possibly damaging Het
Gdf2 A G 14: 33,945,307 T329A probably benign Het
Hcn4 T A 9: 58,824,275 I255N unknown Het
Hk3 T G 13: 55,011,011 D485A probably damaging Het
Hook3 T C 8: 26,072,291 T249A probably benign Het
Kcp C T 6: 29,498,520 probably benign Het
Kifc2 G T 15: 76,666,281 R515L possibly damaging Het
Kiss1r A G 10: 79,920,750 Y142C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klrb1a T A 6: 128,619,163 I72L probably benign Het
Lep T A 6: 29,070,863 F62Y probably damaging Het
Lrtm1 A G 14: 29,021,844 T90A probably benign Het
Mug1 A T 6: 121,888,913 D1472V probably benign Het
Ncor2 G T 5: 125,026,930 P1988Q probably benign Het
Nlrp4a C T 7: 26,450,492 S508L probably benign Het
Obp2b T A 2: 25,737,143 D29E probably benign Het
Olfr1123 G A 2: 87,418,668 V207M possibly damaging Het
Olfr1214 A G 2: 88,988,100 L34P possibly damaging Het
Olfr1224-ps1 A T 2: 89,156,457 C239* probably null Het
Olfr725 T C 14: 50,035,288 I38M possibly damaging Het
Olfr803 A G 10: 129,691,732 I103T probably damaging Het
Otof A G 5: 30,370,139 S1985P probably damaging Het
Oxct2a A T 4: 123,323,093 V165E probably damaging Het
Papd5 C A 8: 88,200,023 H20Q possibly damaging Het
Pcdhgb7 T C 18: 37,753,097 V440A possibly damaging Het
Pelp1 C A 11: 70,401,661 G211C probably damaging Het
Phox2a A G 7: 101,822,105 H268R probably benign Het
Pik3c2g T C 6: 139,896,257 probably null Het
Pramel1 T A 4: 143,398,586 M360K probably benign Het
Rbm6 C T 9: 107,852,657 R132K probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc45a1 T C 4: 150,638,270 T386A probably damaging Het
Smad2 A G 18: 76,288,053 Y151C probably damaging Het
Sptbn2 G A 19: 4,750,082 G2188D probably benign Het
Sugt1 G A 14: 79,602,901 probably null Het
Tead1 G T 7: 112,861,545 D219Y probably damaging Het
Tenm2 G T 11: 36,047,201 Y1548* probably null Het
Tenm3 T A 8: 48,229,198 I2466F possibly damaging Het
Tgm2 G A 2: 158,129,438 P294S probably damaging Het
Tns2 T C 15: 102,111,453 S585P probably damaging Het
Ttc41 A G 10: 86,730,942 K491E probably benign Het
Ttn G A 2: 76,791,551 T15549I probably damaging Het
Vmn1r157 T C 7: 22,761,758 L21P probably damaging Het
Vmn2r81 A G 10: 79,247,986 M65V probably benign Het
Wdr34 T A 2: 30,032,363 probably benign Het
Zcchc14 T C 8: 121,618,694 probably benign Het
Other mutations in Tctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Tctn3 APN 19 40597421 missense probably damaging 0.99
IGL01326:Tctn3 APN 19 40597436 missense probably damaging 1.00
IGL01351:Tctn3 APN 19 40607637 missense probably benign 0.00
IGL01604:Tctn3 APN 19 40605302 splice site probably null
IGL01844:Tctn3 APN 19 40612137 missense probably damaging 0.99
IGL02469:Tctn3 APN 19 40597523 missense probably benign 0.01
FR4449:Tctn3 UTSW 19 40607202 intron probably benign
R0333:Tctn3 UTSW 19 40607267 missense possibly damaging 0.86
R0409:Tctn3 UTSW 19 40611416 splice site probably benign
R1573:Tctn3 UTSW 19 40608917 nonsense probably null
R2288:Tctn3 UTSW 19 40605713 missense probably damaging 1.00
R3792:Tctn3 UTSW 19 40611711 missense probably benign 0.00
R3916:Tctn3 UTSW 19 40607649 missense possibly damaging 0.68
R4033:Tctn3 UTSW 19 40597323 missense probably benign 0.23
R4728:Tctn3 UTSW 19 40605742 missense probably damaging 1.00
R5093:Tctn3 UTSW 19 40612104 missense probably damaging 0.99
R5334:Tctn3 UTSW 19 40602822 missense probably benign 0.16
R5620:Tctn3 UTSW 19 40608917 nonsense probably null
R6143:Tctn3 UTSW 19 40609227 missense probably benign 0.03
R6166:Tctn3 UTSW 19 40597479 missense possibly damaging 0.92
R7629:Tctn3 UTSW 19 40611336 missense probably damaging 1.00
Z1088:Tctn3 UTSW 19 40607346 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTCAATTAAGACCAAAGCAGGC -3'
(R):5'- GCCCACGCTATTTTGGTTAATGG -3'

Sequencing Primer
(F):5'- GACCAAAGCAGGCCTTAATATTTGG -3'
(R):5'- CACGCTATTTTGGTTAATGGATGCTC -3'
Posted On2016-07-06