Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Insr'

399289

Institutional Source

Beutler Lab

Gene Symbol

Insr

Ensembl Gene

ENSMUSG00000005534

Gene Name

insulin receptor

Synonyms

IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220

MMRRC Submission

042756-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.889) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3122061-3279617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3158742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1240 (M1240L)

Ref Sequence

ENSEMBL: ENSMUSP00000088837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091291]

AlphaFold

P15208

PDB Structure

1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000091291
AA Change: M1240L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: M1240L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208839
AA Change: M64L

Meta Mutation Damage Score

0.1651

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Insr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Insr	APN	8	3258682	missense	probably damaging	1.00
IGL01986:Insr	APN	8	3158817	missense	probably damaging	1.00
IGL02135:Insr	APN	8	3258741	missense	probably damaging	1.00
IGL02203:Insr	APN	8	3155817	missense	probably benign	0.18
IGL02220:Insr	APN	8	3159578	missense	probably damaging	1.00
IGL02678:Insr	APN	8	3173570	missense	probably benign	0.00
IGL02961:Insr	APN	8	3258785	missense	probably benign	0.08
IGL03099:Insr	APN	8	3258715	missense	probably damaging	1.00
IGL03125:Insr	APN	8	3184972	missense	possibly damaging	0.87
IGL03290:Insr	APN	8	3258574	missense	probably damaging	1.00
gummi_bear	UTSW	8	3161770	missense	probably damaging	1.00
jellybelly	UTSW	8	3258841	missense	probably damaging	1.00
Patently	UTSW	8	3159475	missense	probably damaging	1.00
trolli	UTSW	8	3198111	missense	probably benign	0.31
R0047:Insr	UTSW	8	3202947	missense	probably damaging	0.97
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0480:Insr	UTSW	8	3161770	missense	probably damaging	1.00
R0748:Insr	UTSW	8	3258841	missense	probably damaging	1.00
R0919:Insr	UTSW	8	3158769	missense	probably damaging	1.00
R1348:Insr	UTSW	8	3192635	missense	probably damaging	1.00
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1568:Insr	UTSW	8	3165576	missense	probably benign
R1768:Insr	UTSW	8	3159561	missense	probably damaging	1.00
R2093:Insr	UTSW	8	3204762	missense	probably damaging	1.00
R2111:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2112:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2352:Insr	UTSW	8	3192593	missense	probably damaging	1.00
R2364:Insr	UTSW	8	3174820	missense	probably benign
R2842:Insr	UTSW	8	3202986	missense	probably damaging	1.00
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R4081:Insr	UTSW	8	3211391	missense	probably benign	0.00
R4441:Insr	UTSW	8	3194902	missense	probably benign	0.00
R4672:Insr	UTSW	8	3167501	critical splice donor site	probably null
R4687:Insr	UTSW	8	3161709	missense	probably benign	0.42
R4708:Insr	UTSW	8	3211346	intron	probably benign
R4890:Insr	UTSW	8	3198234	missense	probably benign	0.16
R4949:Insr	UTSW	8	3185059	missense	probably benign	0.04
R4996:Insr	UTSW	8	3192665	missense	probably null	0.98
R5073:Insr	UTSW	8	3159475	missense	probably damaging	1.00
R5200:Insr	UTSW	8	3198059	critical splice donor site	probably null
R5323:Insr	UTSW	8	3202902	missense	probably benign	0.02
R5453:Insr	UTSW	8	3155694	missense	probably benign	0.06
R5516:Insr	UTSW	8	3155764	nonsense	probably null
R5704:Insr	UTSW	8	3185122	missense	possibly damaging	0.52
R5820:Insr	UTSW	8	3155976	missense	probably damaging	1.00
R5879:Insr	UTSW	8	3198173	nonsense	probably null
R5894:Insr	UTSW	8	3174869	missense	possibly damaging	0.88
R5937:Insr	UTSW	8	3174808	missense	probably benign
R5966:Insr	UTSW	8	3258697	missense	probably benign	0.04
R6134:Insr	UTSW	8	3192572	missense	probably damaging	1.00
R6352:Insr	UTSW	8	3173479	critical splice donor site	probably null
R6423:Insr	UTSW	8	3173566	missense	probably benign
R6687:Insr	UTSW	8	3198111	missense	probably benign	0.31
R6985:Insr	UTSW	8	3161372	missense	possibly damaging	0.87
R6993:Insr	UTSW	8	3258752	missense	probably damaging	1.00
R7041:Insr	UTSW	8	3258418	missense	probably benign
R7109:Insr	UTSW	8	3258481	missense	probably benign	0.33
R7216:Insr	UTSW	8	3203034	missense	possibly damaging	0.53
R7287:Insr	UTSW	8	3169717	missense	probably benign	0.00
R7378:Insr	UTSW	8	3198231	missense	probably damaging	1.00
R7525:Insr	UTSW	8	3192642	missense	probably damaging	1.00
R7572:Insr	UTSW	8	3173602	missense	probably benign	0.11
R7636:Insr	UTSW	8	3258709	missense	probably damaging	1.00
R7684:Insr	UTSW	8	3169753	missense	possibly damaging	0.85
R7840:Insr	UTSW	8	3258415	missense	probably benign	0.04
R8075:Insr	UTSW	8	3155862	missense	probably benign	0.17
R8161:Insr	UTSW	8	3258660	missense	probably damaging	1.00
R8220:Insr	UTSW	8	3158702	missense	probably benign	0.01
R8434:Insr	UTSW	8	3165514	splice site	probably benign
R8810:Insr	UTSW	8	3169714	missense	probably benign
R8865:Insr	UTSW	8	3161358	missense	probably damaging	1.00
R8884:Insr	UTSW	8	3155679	missense	probably benign
R9134:Insr	UTSW	8	3258413	missense	probably damaging	1.00
R9359:Insr	UTSW	8	3158717	missense	probably damaging	1.00
R9407:Insr	UTSW	8	3185106	missense	probably benign
R9647:Insr	UTSW	8	3155874	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGCGAATACAAGCCTGGATGTAAAG -3'
(R):5'- GGTCAACAAAGTTCTAGTAAGCC -3'

Sequencing Primer
(F):5'- GGCATGCTATATAAACATATGTGGGC -3'
(R):5'- CAACAAAGTTCTAGTAAGCCAAAAGG -3'

Posted On

2016-07-06