Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Trappc11'

399290

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

042756-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 47510963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 601 (V601L)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]

AlphaFold

B2RXC1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039061
AA Change: V601L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: V601L

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120987

SMART Domains

Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

Domain	Start	End	E-Value	Type
Pfam:Gryzun	1	155	4e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bantu	UTSW	8	47498666	missense	probably benign	0.44
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47519678	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47493313	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTCTAGCCAACATCAGATAACGAG -3'
(R):5'- GCTGTGTGCTCACTGTAAAGATG -3'

Sequencing Primer
(F):5'- CCAACATCAGATAACGAGTAAGATG -3'
(R):5'- GTGCTCACTGTAAAGATGACTCAGC -3'

Posted On

2016-07-06