Incidental Mutation 'R5176:Rhou'
ID399293
Institutional Source Beutler Lab
Gene Symbol Rhou
Ensembl Gene ENSMUSG00000039960
Gene Nameras homolog family member U
Synonyms2310026M05Rik, WRCH-1, mG28K, CDC42L1, WRCH1, Arhu
MMRRC Submission 042756-MU
Accession Numbers

Genbank: NM_133955; MGI: 1916831

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5176 (G1)
Quality Score152
Status Not validated
Chromosome8
Chromosomal Location123653929-123663884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123654109 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 55 (C55F)
Ref Sequence ENSEMBL: ENSMUSP00000038915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045487] [ENSMUST00000127664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045487
AA Change: C55F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038915
Gene: ENSMUSG00000039960
AA Change: C55F

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
RHO 55 228 5.59e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136615
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho family of GTPases. This protein can activate PAK1 and JNK1, and can induce filopodium formation and stress fiber dissolution. It may also mediate the effects of WNT1 signaling in the regulation of cell morphology, cytoskeletal organization, and cell proliferation. A non-coding transcript variant of this gene results from naturally occurring read-through transcription between this locus and the neighboring DUSP5P (dual specificity phosphatase 5 pseudogene) locus.[provided by RefSeq, Mar 2011]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Rhou
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Rhou APN 8 123654141 missense possibly damaging 0.60
A5278:Rhou UTSW 8 123660991 missense probably damaging 0.99
R0926:Rhou UTSW 8 123660976 missense probably damaging 1.00
R1467:Rhou UTSW 8 123661290 missense possibly damaging 0.94
R1467:Rhou UTSW 8 123661290 missense possibly damaging 0.94
R1873:Rhou UTSW 8 123661251 missense probably damaging 1.00
R2276:Rhou UTSW 8 123655519 missense probably damaging 1.00
R2937:Rhou UTSW 8 123661141 missense possibly damaging 0.65
R5107:Rhou UTSW 8 123661173 nonsense probably null
R6172:Rhou UTSW 8 123661164 missense probably benign 0.07
R7053:Rhou UTSW 8 123654195 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTGGTCTCGGATAGAAG -3'
(R):5'- AAGATCCGCTGGAAGTGAGC -3'

Sequencing Primer
(F):5'- TGTCGCAGGGAAGCCTG -3'
(R):5'- AAGGCCACCTGAGCTGCAG -3'
Posted On2016-07-06