Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Olfr836'

399295

Institutional Source

Beutler Lab

Gene Symbol

Olfr836

Ensembl Gene

ENSMUSG00000059303

Gene Name

olfactory receptor 836

Synonyms

MOR152-3, GA_x6K02T2PVTD-12857805-12858749

MMRRC Submission

042756-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19120382-19125938 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19121360 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 132 (Y132F)

Ref Sequence

ENSEMBL: ENSMUSP00000150026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074986] [ENSMUST00000212730] [ENSMUST00000215981]

AlphaFold

Q8VFJ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000074986
AA Change: Y135F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074514
Gene: ENSMUSG00000059303
AA Change: Y135F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	34	311	1.2e-50	PFAM
Pfam:7TM_GPCR_Srsx	38	210	9.6e-6	PFAM
Pfam:7tm_1	44	293	2.4e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212730
AA Change: Y132F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215981
AA Change: Y132F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Olfr836

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00907:Olfr836	APN	9	19121232	missense	possibly damaging	0.88
IGL01316:Olfr836	APN	9	19121422	missense	probably benign	0.10
IGL01412:Olfr836	APN	9	19121599	missense	probably benign	0.00
IGL01815:Olfr836	APN	9	19121326	missense	probably damaging	1.00
IGL02003:Olfr836	APN	9	19121065	missense	probably benign	0.06
IGL02313:Olfr836	APN	9	19121375	missense	probably damaging	0.99
IGL03185:Olfr836	APN	9	19121738	missense	probably damaging	1.00
IGL03186:Olfr836	APN	9	19121904	missense	probably benign	0.16
R1337:Olfr836	UTSW	9	19121803	missense	probably benign
R2267:Olfr836	UTSW	9	19121441	missense	probably benign	0.22
R3969:Olfr836	UTSW	9	19121660	missense	probably benign	0.00
R4695:Olfr836	UTSW	9	19121010	missense	probably null	0.04
R4976:Olfr836	UTSW	9	19121501	missense	probably damaging	1.00
R5379:Olfr836	UTSW	9	19121077	missense	probably damaging	1.00
R5638:Olfr836	UTSW	9	19121380	missense	probably benign	0.00
R6084:Olfr836	UTSW	9	19121327	missense	probably damaging	1.00
R6236:Olfr836	UTSW	9	19121113	missense	possibly damaging	0.92
R6329:Olfr836	UTSW	9	19120957	start codon destroyed	probably benign	0.08
R7151:Olfr836	UTSW	9	19121741	missense	possibly damaging	0.91
R7326:Olfr836	UTSW	9	19121669	missense	probably benign	0.42
R8460:Olfr836	UTSW	9	19121692	missense	probably damaging	1.00
R8767:Olfr836	UTSW	9	19121626	missense	possibly damaging	0.95
R8978:Olfr836	UTSW	9	19121286	nonsense	probably null
R9099:Olfr836	UTSW	9	19121594	missense	probably benign	0.35
R9220:Olfr836	UTSW	9	19121897	missense	possibly damaging	0.82
R9236:Olfr836	UTSW	9	19121910	makesense	probably null
R9265:Olfr836	UTSW	9	19121688	nonsense	probably null
R9530:Olfr836	UTSW	9	19121755	missense	probably benign	0.24
R9612:Olfr836	UTSW	9	19121464	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- ATATTGGCCATCATTTGTGACTCTC -3'
(R):5'- GCAAGCTTGAGGATTTGTGC -3'

Sequencing Primer
(F):5'- TGTATTTAATCAGCATTACAGTCCC -3'
(R):5'- CAAGCTTGAGGATTTGTGCAATTTC -3'

Posted On

2016-07-06