Incidental Mutation 'R5176:Arhgef12'
ID 399297
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene Name Rho guanine nucleotide exchange factor 12
Synonyms 2310014B11Rik, LARG
MMRRC Submission 042756-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R5176 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 42875138-43017069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42931982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 168 (H168Q)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
AlphaFold Q8R4H2
Predicted Effect possibly damaging
Transcript: ENSMUST00000072767
AA Change: H168Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: H168Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217502
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 C A 10: 79,834,123 (GRCm39) H116Q probably benign Het
Akap12 G T 10: 4,303,947 (GRCm39) E252D probably benign Het
Apobr A G 7: 126,184,188 (GRCm39) D2G probably damaging Het
Asb3 T A 11: 31,031,357 (GRCm39) probably null Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Cacna1b A T 2: 24,525,143 (GRCm39) Y1679N probably damaging Het
Ccdc69 C T 11: 54,951,296 (GRCm39) A42T probably benign Het
Cds1 G T 5: 101,929,286 (GRCm39) D55Y possibly damaging Het
Cep135 C A 5: 76,784,873 (GRCm39) D989E probably benign Het
Cpsf6 C A 10: 117,197,189 (GRCm39) probably benign Het
Ctif C T 18: 75,770,290 (GRCm39) V32M probably damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dao T C 5: 114,158,070 (GRCm39) probably null Het
Dop1a T A 9: 86,403,868 (GRCm39) N1689K probably damaging Het
Dop1b A G 16: 93,536,931 (GRCm39) Y14C probably damaging Het
Fam187a C T 11: 102,777,290 (GRCm39) R365C probably damaging Het
Fastkd2 A G 1: 63,770,598 (GRCm39) probably benign Het
Fhip2a A G 19: 57,359,613 (GRCm39) N51S probably damaging Het
Fkbp15 G T 4: 62,230,560 (GRCm39) L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 (GRCm39) V118F probably damaging Het
Gm13991 T A 2: 116,358,508 (GRCm39) noncoding transcript Het
H2-M9 T C 17: 36,952,523 (GRCm39) I174M probably damaging Het
Ift70a2 T C 2: 75,807,421 (GRCm39) M364V probably benign Het
Insr T A 8: 3,208,742 (GRCm39) M1240L probably benign Het
Ints15 G T 5: 143,300,830 (GRCm39) S7* probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Mad2l1bp T A 17: 46,463,738 (GRCm39) E95D probably benign Het
Marchf9 T C 10: 126,895,319 (GRCm39) D102G probably benign Het
Muc19 A G 15: 91,776,374 (GRCm39) noncoding transcript Het
Nr1h4 T A 10: 89,334,117 (GRCm39) Y91F probably benign Het
Nr5a2 A T 1: 136,876,540 (GRCm39) M1K probably null Het
Oprd1 T C 4: 131,841,104 (GRCm39) T285A probably benign Het
Optc T C 1: 133,829,822 (GRCm39) N196S probably benign Het
Or51f5 T A 7: 102,424,513 (GRCm39) S261T probably damaging Het
Or5g29 A C 2: 85,421,779 (GRCm39) K298N possibly damaging Het
Or7g21 A T 9: 19,032,656 (GRCm39) Y132F probably damaging Het
Panx2 G T 15: 88,944,431 (GRCm39) R52L probably damaging Het
Pdzd8 A G 19: 59,333,389 (GRCm39) F211L probably damaging Het
Pot1b T A 17: 56,006,995 (GRCm39) T41S probably benign Het
Prss56 T C 1: 87,111,880 (GRCm39) L37S probably damaging Het
Ptk2b T C 14: 66,393,864 (GRCm39) T870A probably damaging Het
Rabep2 C A 7: 126,033,465 (GRCm39) probably benign Het
Rbm48 A C 5: 3,645,444 (GRCm39) V80G probably damaging Het
Rhou G T 8: 124,380,848 (GRCm39) C55F possibly damaging Het
Rnaseh2c A G 19: 5,652,070 (GRCm39) D45G probably benign Het
Rusc1 A G 3: 88,996,389 (GRCm39) S109P probably damaging Het
Ryr3 T C 2: 112,588,012 (GRCm39) D2643G possibly damaging Het
Septin4 T A 11: 87,458,358 (GRCm39) M244K probably benign Het
Sik2 T C 9: 50,810,703 (GRCm39) E471G probably benign Het
Sipa1 A G 19: 5,709,406 (GRCm39) S310P probably damaging Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spen T C 4: 141,203,587 (GRCm39) E1680G unknown Het
Steap3 C T 1: 120,171,497 (GRCm39) probably null Het
Tmeff2 T A 1: 51,110,700 (GRCm39) C171* probably null Het
Tmem138 A T 19: 10,552,634 (GRCm39) M33K probably benign Het
Trappc11 C A 8: 47,963,998 (GRCm39) V601L possibly damaging Het
Ttll4 C A 1: 74,718,445 (GRCm39) H99N probably damaging Het
Uchl4 A T 9: 64,143,022 (GRCm39) K168* probably null Het
Wdr17 C T 8: 55,106,913 (GRCm39) probably null Het
Xpo1 A G 11: 23,245,977 (GRCm39) D1029G probably damaging Het
Zfp719 G T 7: 43,240,549 (GRCm39) K712N probably damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 42,931,920 (GRCm39) missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42,893,296 (GRCm39) missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42,901,351 (GRCm39) missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 42,934,137 (GRCm39) missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42,883,563 (GRCm39) missense probably benign
IGL02135:Arhgef12 APN 9 42,883,461 (GRCm39) missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 42,912,748 (GRCm39) missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42,893,339 (GRCm39) missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42,903,859 (GRCm39) missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 42,916,919 (GRCm39) missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 42,917,200 (GRCm39) nonsense probably null
IGL02803:Arhgef12 APN 9 42,883,324 (GRCm39) missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 42,912,268 (GRCm39) missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 42,927,216 (GRCm39) missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42,910,373 (GRCm39) missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 42,937,524 (GRCm39) missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42,885,866 (GRCm39) missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42,903,829 (GRCm39) splice site probably benign
IGL03398:Arhgef12 APN 9 42,889,522 (GRCm39) missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42,889,529 (GRCm39) missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 42,916,890 (GRCm39) missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42,883,300 (GRCm39) missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 42,931,982 (GRCm39) missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 42,929,697 (GRCm39) missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42,882,286 (GRCm39) splice site probably null
R0658:Arhgef12 UTSW 9 42,893,281 (GRCm39) missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42,904,324 (GRCm39) missense probably benign 0.02
R0693:Arhgef12 UTSW 9 42,929,697 (GRCm39) missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42,883,677 (GRCm39) missense probably benign 0.00
R1147:Arhgef12 UTSW 9 42,955,552 (GRCm39) unclassified probably benign
R1395:Arhgef12 UTSW 9 42,917,166 (GRCm39) missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 42,938,516 (GRCm39) missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42,903,874 (GRCm39) splice site probably benign
R1458:Arhgef12 UTSW 9 42,900,294 (GRCm39) missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42,908,956 (GRCm39) missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 42,932,013 (GRCm39) makesense probably null
R1773:Arhgef12 UTSW 9 42,916,838 (GRCm39) critical splice donor site probably null
R1895:Arhgef12 UTSW 9 42,917,152 (GRCm39) missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42,890,768 (GRCm39) missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 42,917,167 (GRCm39) missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 42,912,302 (GRCm39) missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42,886,588 (GRCm39) missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42,886,588 (GRCm39) missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42,883,570 (GRCm39) missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 42,929,645 (GRCm39) nonsense probably null
R4327:Arhgef12 UTSW 9 42,886,525 (GRCm39) nonsense probably null
R4462:Arhgef12 UTSW 9 42,893,278 (GRCm39) missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42,888,958 (GRCm39) missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 42,921,489 (GRCm39) missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42,893,266 (GRCm39) missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42,883,449 (GRCm39) missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 42,931,992 (GRCm39) missense probably benign
R4840:Arhgef12 UTSW 9 42,886,364 (GRCm39) missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42,904,361 (GRCm39) nonsense probably null
R5426:Arhgef12 UTSW 9 42,897,880 (GRCm39) missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 42,921,489 (GRCm39) missense probably benign 0.27
R5838:Arhgef12 UTSW 9 42,916,904 (GRCm39) missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42,900,261 (GRCm39) missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42,883,503 (GRCm39) missense probably benign 0.05
R6959:Arhgef12 UTSW 9 42,927,249 (GRCm39) missense probably benign
R7252:Arhgef12 UTSW 9 42,927,205 (GRCm39) missense probably benign 0.17
R7470:Arhgef12 UTSW 9 42,951,848 (GRCm39) missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42,903,832 (GRCm39) missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 42,938,567 (GRCm39) missense probably damaging 1.00
R7980:Arhgef12 UTSW 9 42,882,595 (GRCm39) nonsense probably null
R8074:Arhgef12 UTSW 9 42,882,399 (GRCm39) nonsense probably null
R8155:Arhgef12 UTSW 9 42,953,958 (GRCm39) missense probably damaging 1.00
R8270:Arhgef12 UTSW 9 42,882,354 (GRCm39) missense probably benign
R8407:Arhgef12 UTSW 9 42,937,475 (GRCm39) critical splice donor site probably null
R8527:Arhgef12 UTSW 9 42,908,944 (GRCm39) missense possibly damaging 0.95
R9116:Arhgef12 UTSW 9 42,893,241 (GRCm39) splice site probably benign
R9127:Arhgef12 UTSW 9 42,885,870 (GRCm39) missense possibly damaging 0.94
R9602:Arhgef12 UTSW 9 42,895,676 (GRCm39) missense probably damaging 1.00
R9665:Arhgef12 UTSW 9 42,929,650 (GRCm39) missense possibly damaging 0.89
R9733:Arhgef12 UTSW 9 42,901,294 (GRCm39) nonsense probably null
R9735:Arhgef12 UTSW 9 42,882,399 (GRCm39) nonsense probably null
R9760:Arhgef12 UTSW 9 42,903,318 (GRCm39) missense probably damaging 1.00
RF020:Arhgef12 UTSW 9 42,901,285 (GRCm39) missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42,882,368 (GRCm39) missense probably benign 0.00
Z1186:Arhgef12 UTSW 9 42,911,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGATTGGACACTGTTTTATAC -3'
(R):5'- GGTACAGTCCTCACTACCACAG -3'

Sequencing Primer
(F):5'- GGACACTGTTTTATACATGACAGG -3'
(R):5'- GTCCTCACTACCACAGATAAAGAG -3'
Posted On 2016-07-06