Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Arhgef12'

399297

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

042756-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43020686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 168 (H168Q)

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

AlphaFold

Q8R4H2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072767
AA Change: H168Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: H168Q

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165665
AA Change: H168Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: H168Q

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213566

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215898

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217502

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43020624	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42982000	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42990055	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43022841	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42972267	missense	probably benign
IGL02135:Arhgef12	APN	9	42972165	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43001452	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42982043	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42992563	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43005623	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43005904	nonsense	probably null
IGL02803:Arhgef12	APN	9	42972028	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43000972	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43015920	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42999077	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43026228	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42974570	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42992533	splice site	probably benign
IGL03398:Arhgef12	APN	9	42978226	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42978233	missense	probably damaging	1.00
R0143:Arhgef12	UTSW	9	43005594	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42972004	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0426:Arhgef12	UTSW	9	42970990	splice site	probably null
R0658:Arhgef12	UTSW	9	42981985	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42993028	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42972381	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43044256	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43005870	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43027220	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42992578	splice site	probably benign
R1458:Arhgef12	UTSW	9	42988998	missense	probably damaging	0.98
R1654:Arhgef12	UTSW	9	42997660	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43020717	makesense	probably null
R1773:Arhgef12	UTSW	9	43005542	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43005856	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42979472	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43005871	missense	probably damaging	1.00
R2421:Arhgef12	UTSW	9	43001006	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42972274	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43018349	nonsense	probably null
R4327:Arhgef12	UTSW	9	42975229	nonsense	probably null
R4462:Arhgef12	UTSW	9	42981982	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42977662	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42981970	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42972153	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43020696	missense	probably benign
R4840:Arhgef12	UTSW	9	42975068	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42993065	nonsense	probably null
R5426:Arhgef12	UTSW	9	42986584	missense	probably damaging	1.00
R5579:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R5838:Arhgef12	UTSW	9	43005608	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42988965	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42972207	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43015953	missense	probably benign
R7252:Arhgef12	UTSW	9	43015909	missense	probably benign	0.17
R7470:Arhgef12	UTSW	9	43040552	missense	probably damaging	1.00
R7658:Arhgef12	UTSW	9	42992536	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43027271	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42971299	nonsense	probably null
R8074:Arhgef12	UTSW	9	42971103	nonsense	probably null
R8155:Arhgef12	UTSW	9	43042662	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42971058	missense	probably benign
R8407:Arhgef12	UTSW	9	43026179	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42997648	missense	possibly damaging	0.95
R9116:Arhgef12	UTSW	9	42981945	splice site	probably benign
R9127:Arhgef12	UTSW	9	42974574	missense	possibly damaging	0.94
R9602:Arhgef12	UTSW	9	42984380	missense	probably damaging	1.00
R9665:Arhgef12	UTSW	9	43018354	missense	possibly damaging	0.89
R9733:Arhgef12	UTSW	9	42989998	nonsense	probably null
R9735:Arhgef12	UTSW	9	42971103	nonsense	probably null
R9760:Arhgef12	UTSW	9	42992022	missense	probably damaging	1.00
RF020:Arhgef12	UTSW	9	42989989	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42971072	missense	probably benign	0.00
Z1186:Arhgef12	UTSW	9	43000015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGGATTGGACACTGTTTTATAC -3'
(R):5'- GGTACAGTCCTCACTACCACAG -3'

Sequencing Primer
(F):5'- GGACACTGTTTTATACATGACAGG -3'
(R):5'- GTCCTCACTACCACAGATAAAGAG -3'

Posted On

2016-07-06